Gene detail

Detail information of GWHGAAZE018386

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010649235.1	4.24859E-38	PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC100246251 [Vitis vinifera]
Swissprot	tr\|P33079\|A10A5_SOYBN	2E-25	Auxin-induced protein 10A5
trEMBL	tr\|A0A068V5X5\|A0A068V5X5_COFCA	1E-27	Coffea canephora DH200=94 genomic scaffold, scaffold_97 {ECO:0000313\|EMBL:CDP15258.1}
TAIR10	AT5G18050.1	3E-21	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18762722	18765584	+
GWHAAZE00000005	mRNA	18762722	18765584	+
GWHAAZE00000005	exon	18762722	18762864	+
GWHAAZE00000005	exon	18764512	18764580	+
GWHAAZE00000005	exon	18765203	18765584	+
GWHAAZE00000005	CDS	18762722	18762864	+
GWHAAZE00000005	CDS	18764512	18764580	+
GWHAAZE00000005	CDS	18765203	18765584	+

Transcript Sequence
>GWHTAAZE018408 ATGGCTATTCGTATGCCTCGTATTGTTCAAGCTAAGCAAATTCTTCGACGTTCTTCGTTCTCATTGAACCACGCGGCTTCCAATGCCGTTGATGTCCCAAAGGGTTATTTTGCGGTTTATGTAGGAGAGCAAGAAATGAAGAGTTTAACGTCCCCAATTACCACAGGTTTATCCAATAAATGGCTCGGTGTTTGCTTATCTGCTCAAACTTGTCTGCCATTGCTAAAGCATCTCGTCTCTTACAAACTACAGAAGAACATCAGTTGCTGCTTCTTTTTTAACAGGAGAATTTTGTTAGAATCATGGGTATTCGATTGCCAAGAATATTGCATGGTAAGCAGACTCTTGTACGAGTTCTTTCTACTCCGACAGCAACTGATCGATGTAGCCAAAGGCCATTTTGCCTTCTATGTTGAAGAAACCAAAATGAAGAGACATGTAGTTCCATTATCATATTTGAACCAACCTTTGTTCCAAAACTTGCTAAGCCAAGCTAAAGAAGAGTTCGGGTTTAATCATCCAATGGGTTGTCTCACAATCCCTTGCAGAGAAGAAACGTTCATTAACGTCACTCGCAGTTTGAAGTGCTCCTGA

Network for GWHGAAZE018386

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	128	194	1.20E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.744
	SRR3591706	second leaf	10.953
	SRR3591707	mature leaf	15.066
	SRR3591708	Shoot apex	4.838
	SRR3591709	Stem	2.091
	SRR3591710	White floral bud	5.717
	SRR3591711	White flower	2.286
	SRR3591712	Green floral bud	3.309
	SRR3591713	Yellow flower	1.041
SRP173429	SRR8316895	Juvenile bud stage	0.853
	SRR8316896	Juvenile bud stage	2.156
	SRR8316897	Juvenile bud stage	0.229
	SRR8316894	Third green stage	0.761
	SRR8316900	Third green stage	4.101
	SRR8316901	Third green stage	3.865
	SRR8316898	Complete white stage	22.323
	SRR8316899	Complete white stage	3.022
	SRR8316903	Complete white stage	27.355
	SRR8316902	Silver flowering stage	6.431
	SRR8316904	Silver flowering stage	9.863
	SRR8316905	Silver flowering stage	5.136
	SRR8316906	Gold flowering stage	14.913
	SRR8316907	Gold flowering stage	12.986
	SRR8316908	Gold flowering stage	18.609
SRP132670	SRR6706286	Control	6.822
	SRR6706287	Light intensity 50%	5.781
	SRR6706288	Light intensity 20%	6.501
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.457
	CNS0095593	Slightly white alabastrum(diploid) 2	3.337
	CNS0095594	Slightly white alabastrum(diploid) 3	1.191
	CNS0095595	Whole white alabastrum(diploid) 2	4.511
	CNS0095596	Whole white alabastrum(diploid) 3	4.146
	CNS0095597	Whole white alabastrum(diploid) 4	3.132
	CNS0095598	Silvery flower (diploied) 1	4.933
	CNS0095599	Silvery flower (diploied) 2	7.979
	CNS0095600	Silvery flower (diploied) 3	11.175
	CNS0095601	Golden flower (diploid) 1	5.806
	CNS0095602	Golden flower (diploid) 2	12.764
	CNS0095603	Golden flower (diploid) 3	10.272
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.443
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.428
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.230
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.537
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.776
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.121
	CNS0095610	Silvery flower (tetraploid) 1	5.920
	CNS0095611	Silvery flower (tetraploid) 2	12.475
	CNS0095612	Silvery flower (tetraploid) 3	9.012
	CNS0095613	Golden flower (tetraploid) 1	11.039
	CNS0095614	Golden flower (tetraploid) 2	10.623
	CNS0095615	Golden flower (tetraploid) 3	14.043
CRA001975	CRR073297	Stem 1	1.181
	CRR073298	Stem 2	0.604
	CRR073299	Stem 3	0.953
	CRR073300	Leaf 1	0.429
	CRR073301	Leaf 2	0.524
	CRR073302	Leaf 3	1.047
	CRR073303	Juvenile bud 1	0.324
	CRR073304	Juvenile bud 2	0.220
	CRR073305	Juvenile bud 3	1.148
	CRR073306	Third green 1	12.284
	CRR073307	Third green 2	18.995
	CRR073308	Third green 3	13.408
	CRR073309	Second white 1	20.974
	CRR073310	Second white 2	15.711
	CRR073311	Second white 3	7.702
	CRR073312	Silver flowering 1	5.794
	CRR073313	Silver flowering 2	4.474
	CRR073314	Silver flowering 3	4.434
	CRR073315	Gold flowering 1	1.004
	CRR073316	Gold flowering 2	1.019
	CRR073317	Gold flowering 3	3.128
	CRR073318	Tawny withering 1	0.504
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.256