Gene detail

Detail information of GWHGAAZE018377

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO96970.1	1.37628E-43	unnamed protein product [Coffea canephora]
Swissprot	tr\|P33079\|A10A5_SOYBN	2E-32	Auxin-induced protein 10A5
trEMBL	tr\|A0A068TKX1\|A0A068TKX1_COFCA	5E-44	Coffea canephora DH200=94 genomic scaffold, scaffold_1 {ECO:0000313\|EMBL:CDO96970.1}
TAIR10	AT4G38840.1	1E-28	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18706623	18706910	+
GWHAAZE00000005	mRNA	18706623	18706910	+
GWHAAZE00000005	exon	18706623	18706910	+
GWHAAZE00000005	CDS	18706623	18706910	+

Transcript Sequence
>GWHTAAZE018399 ATGGGTATCCATATGCCTCGTATTATCCAAGCTAAACAAATTCTTCGAAGGACTTCCTTTACAGCAGCTTCAACAGCTGTAGATGTCCCAAAGGGCTATTTTGCAGTTTATGTCAGAGAGCAAGAAAAGAAGAGATTTGTAGTTCCAATATCCTTCTTGAAAGAGCCTTCTTTCCAAGACTTGTTAAGTCAGTCCGAGGAAGAATTTGGGTTTGATCACCCAATGGGTGGTCTCACAATTCCCTGCAGACAAGACATTTTCACTGACATCACTTGTCGTATGAGATAG

Network for GWHGAAZE018377

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	16	93	5.00E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.025
	SRR3591706	second leaf	2.154
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	2.547
	SRR3591709	Stem	1.164
	SRR3591710	White floral bud	4.867
	SRR3591711	White flower	8.045
	SRR3591712	Green floral bud	5.580
	SRR3591713	Yellow flower	0.025
SRP173429	SRR8316895	Juvenile bud stage	0.333
	SRR8316896	Juvenile bud stage	1.095
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.891
	SRR8316900	Third green stage	14.061
	SRR8316901	Third green stage	6.768
	SRR8316898	Complete white stage	12.503
	SRR8316899	Complete white stage	7.023
	SRR8316903	Complete white stage	19.192
	SRR8316902	Silver flowering stage	15.000
	SRR8316904	Silver flowering stage	18.389
	SRR8316905	Silver flowering stage	13.232
	SRR8316906	Gold flowering stage	24.398
	SRR8316907	Gold flowering stage	23.493
	SRR8316908	Gold flowering stage	17.383
SRP132670	SRR6706286	Control	0.928
	SRR6706287	Light intensity 50%	1.314
	SRR6706288	Light intensity 20%	0.759
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.400
	CNS0095593	Slightly white alabastrum(diploid) 2	10.687
	CNS0095594	Slightly white alabastrum(diploid) 3	4.198
	CNS0095595	Whole white alabastrum(diploid) 2	18.640
	CNS0095596	Whole white alabastrum(diploid) 3	21.134
	CNS0095597	Whole white alabastrum(diploid) 4	10.630
	CNS0095598	Silvery flower (diploied) 1	6.373
	CNS0095599	Silvery flower (diploied) 2	13.437
	CNS0095600	Silvery flower (diploied) 3	12.890
	CNS0095601	Golden flower (diploid) 1	4.531
	CNS0095602	Golden flower (diploid) 2	3.219
	CNS0095603	Golden flower (diploid) 3	3.124
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.438
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.450
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.706
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.937
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.383
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.253
	CNS0095610	Silvery flower (tetraploid) 1	6.679
	CNS0095611	Silvery flower (tetraploid) 2	10.299
	CNS0095612	Silvery flower (tetraploid) 3	1.532
	CNS0095613	Golden flower (tetraploid) 1	3.913
	CNS0095614	Golden flower (tetraploid) 2	0.615
	CNS0095615	Golden flower (tetraploid) 3	21.085
CRA001975	CRR073297	Stem 1	1.497
	CRR073298	Stem 2	0.620
	CRR073299	Stem 3	0.111
	CRR073300	Leaf 1	0.736
	CRR073301	Leaf 2	2.641
	CRR073302	Leaf 3	0.743
	CRR073303	Juvenile bud 1	1.037
	CRR073304	Juvenile bud 2	0.195
	CRR073305	Juvenile bud 3	0.547
	CRR073306	Third green 1	6.704
	CRR073307	Third green 2	8.442
	CRR073308	Third green 3	6.604
	CRR073309	Second white 1	8.473
	CRR073310	Second white 2	5.492
	CRR073311	Second white 3	0.305
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000