Gene detail

Detail information of GWHGAAZE018375

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010030680.1	6.463E-43	PREDICTED: uncharacterized protein LOC104420559 [Eucalyptus grandis]
Swissprot	tr\|P33082\|AXX15_SOYBN	1E-22	Auxin-induced protein X15
trEMBL	tr\|A0A068VC38\|A0A068VC38_COFCA	5E-37	Coffea canephora DH200=94 genomic scaffold, scaffold_235 {ECO:0000313\|EMBL:CDP18415.1}
TAIR10	AT4G38840.1	1E-16	SAUR-like auxin-responsive protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	18688663	18690580	+
GWHAAZE00000005	mRNA	18688663	18690580	+
GWHAAZE00000005	exon	18688663	18688888	+
GWHAAZE00000005	exon	18690414	18690580	+
GWHAAZE00000005	CDS	18688663	18688888	+
GWHAAZE00000005	CDS	18690414	18690580	+

Transcript Sequence
>GWHTAAZE018397 ATGGATATCTGTATTTGTATTATTCATGCTAAGAAACTTCTTAGAACATCTTCATTTAGAGCATCTTCGACCACTTTAGATGTCCTTAAAGGCTATTTTGCTGTTTATGTTGGAGAGAAGGAAAATAAGAGATTTGTGATTCCAGTTTCGTCCTTGAACCAGCCTTCATTTCAGGACTTGTTAAGTCAAGCCAAGGAAGAGTTCAGGTTTGATCATCCAATGGGAGATTCGACCGCTTTAGATGTCCCCAAGGGATATTTTGCGGTTTATGTTGGAAAGCACGAAAAGAAGCGATATGTAATCCCTATATCGTTCTTGAAACAGCCTTCGTTCCAAGACCTCTTAACTCAGGCTGAGGAAGAGTTCGGTTTGATCATCCAATGGGTGGTCTGA

Network for GWHGAAZE018375

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02519.15	Auxin_inducible	17	73	6.20E-15
PF02519.15	Auxin_inducible	78	124	1.10E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14488	SAUR	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0009733	biological_process	response to auxin

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.947
	SRR3591706	second leaf	1.900
	SRR3591707	mature leaf	0.467
	SRR3591708	Shoot apex	0.644
	SRR3591709	Stem	1.583
	SRR3591710	White floral bud	13.659
	SRR3591711	White flower	10.069
	SRR3591712	Green floral bud	3.039
	SRR3591713	Yellow flower	0.591
SRP173429	SRR8316895	Juvenile bud stage	0.444
	SRR8316896	Juvenile bud stage	0.833
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.775
	SRR8316900	Third green stage	3.399
	SRR8316901	Third green stage	3.031
	SRR8316898	Complete white stage	8.197
	SRR8316899	Complete white stage	3.490
	SRR8316903	Complete white stage	13.743
	SRR8316902	Silver flowering stage	10.240
	SRR8316904	Silver flowering stage	15.799
	SRR8316905	Silver flowering stage	10.949
	SRR8316906	Gold flowering stage	23.261
	SRR8316907	Gold flowering stage	13.202
	SRR8316908	Gold flowering stage	13.416
SRP132670	SRR6706286	Control	0.813
	SRR6706287	Light intensity 50%	0.800
	SRR6706288	Light intensity 20%	0.763
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.120
	CNS0095593	Slightly white alabastrum(diploid) 2	2.266
	CNS0095594	Slightly white alabastrum(diploid) 3	0.319
	CNS0095595	Whole white alabastrum(diploid) 2	3.411
	CNS0095596	Whole white alabastrum(diploid) 3	4.299
	CNS0095597	Whole white alabastrum(diploid) 4	3.343
	CNS0095598	Silvery flower (diploied) 1	3.756
	CNS0095599	Silvery flower (diploied) 2	5.601
	CNS0095600	Silvery flower (diploied) 3	8.427
	CNS0095601	Golden flower (diploid) 1	1.031
	CNS0095602	Golden flower (diploid) 2	2.096
	CNS0095603	Golden flower (diploid) 3	1.363
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.941
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.245
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.956
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.427
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.240
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.315
	CNS0095610	Silvery flower (tetraploid) 1	2.509
	CNS0095611	Silvery flower (tetraploid) 2	6.033
	CNS0095612	Silvery flower (tetraploid) 3	2.428
	CNS0095613	Golden flower (tetraploid) 1	0.800
	CNS0095614	Golden flower (tetraploid) 2	0.513
	CNS0095615	Golden flower (tetraploid) 3	10.950
CRA001975	CRR073297	Stem 1	0.719
	CRR073298	Stem 2	0.911
	CRR073299	Stem 3	0.119
	CRR073300	Leaf 1	1.416
	CRR073301	Leaf 2	1.465
	CRR073302	Leaf 3	2.748
	CRR073303	Juvenile bud 1	2.867
	CRR073304	Juvenile bud 2	1.782
	CRR073305	Juvenile bud 3	1.526
	CRR073306	Third green 1	9.053
	CRR073307	Third green 2	18.822
	CRR073308	Third green 3	9.714
	CRR073309	Second white 1	1.455
	CRR073310	Second white 2	2.357
	CRR073311	Second white 3	0.469
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.026
	CRR073316	Gold flowering 2	0.201
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000