Gene detail

Detail information of GWHGAAZE018204

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO98612.1	2.2748E-112	unnamed protein product [Coffea canephora]
Swissprot	tr\|A4VCM0\|NAC45_ARATH	2E-54	NAC domain-containing protein 45 {ECO:0000312\|EMBL:AEE73912.1}
trEMBL	tr\|A0A068TRH5\|A0A068TRH5_COFCA	8E-113	Coffea canephora DH200=94 genomic scaffold, scaffold_2 {ECO:0000313\|EMBL:CDO98612.1}
TAIR10	AT3G17730.1	2E-70	NAC domain containing protein 57

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	16568347	16571370	+
GWHAAZE00000005	mRNA	16568347	16571370	+
GWHAAZE00000005	exon	16568347	16568685	+
GWHAAZE00000005	exon	16571086	16571370	+
GWHAAZE00000005	CDS	16568347	16568685	+
GWHAAZE00000005	CDS	16571086	16571370	+

Transcript Sequence
>GWHTAAZE018226 ATGCACCCGGAAGAGTTCATTTTAGTTGAATGTGGGAAAATGTATAATGATTGCATTGCAGAGAAGTCATTTTTGCCAAGTAGAGATCCAGAGTGGTACTTTTTTGGGCCAAGGGACCGAAAGTACCCGAACGGATTCAGAACAAATAGAGCAACGAGAGCGGGATACTGGAAATCAACGGGCAAAGATAGGAGGGTTAGCCATCAGAACAGAGCCATCGGAATGAAGAAGACTCTGGTTTACTATAGAGGCCGAGCACCGCAAGGAATAAGGACTGACTGGGTTATGCACGAGTATCGCCTCGACGATAAAGAATGCGAGGACACGTCCGGTATTCAGGACTCATATGCATTGTGTCGAGTGTTCAAGAAAAACGGGGTGTGCTCCGAGATCGAAGATCAAGGCCAATCTTCATCAACCATATCGTCATCGTTAATCGAATACTCTCAAGGGGTCATCAACGACTACGAAACAATGTCACCAGATGTTCCCCTAACATCAAACTCGCCGTGCATGGAAATCGAGGAGGATAAAGACGATTCGTGGATGCAATTCATCACAGACGATGCGTGGTGTTCCTCCAATACTCCCATTGGCAGTGAACAAGTCTCTTTCACGAATTAA

Network for GWHGAAZE018204

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	27	101	2.10E-19

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.630
	SRR3591706	second leaf	5.292
	SRR3591707	mature leaf	0.165
	SRR3591708	Shoot apex	6.775
	SRR3591709	Stem	14.758
	SRR3591710	White floral bud	2.646
	SRR3591711	White flower	0.452
	SRR3591712	Green floral bud	4.643
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.489
	SRR8316896	Juvenile bud stage	2.630
	SRR8316897	Juvenile bud stage	1.390
	SRR8316894	Third green stage	1.615
	SRR8316900	Third green stage	1.949
	SRR8316901	Third green stage	2.972
	SRR8316898	Complete white stage	0.174
	SRR8316899	Complete white stage	1.647
	SRR8316903	Complete white stage	0.162
	SRR8316902	Silver flowering stage	0.059
	SRR8316904	Silver flowering stage	0.110
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.687
	SRR6706287	Light intensity 50%	0.869
	SRR6706288	Light intensity 20%	0.780
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.126
	CNS0095593	Slightly white alabastrum(diploid) 2	6.331
	CNS0095594	Slightly white alabastrum(diploid) 3	5.210
	CNS0095595	Whole white alabastrum(diploid) 2	2.069
	CNS0095596	Whole white alabastrum(diploid) 3	1.223
	CNS0095597	Whole white alabastrum(diploid) 4	0.712
	CNS0095598	Silvery flower (diploied) 1	0.381
	CNS0095599	Silvery flower (diploied) 2	0.526
	CNS0095600	Silvery flower (diploied) 3	0.102
	CNS0095601	Golden flower (diploid) 1	1.485
	CNS0095602	Golden flower (diploid) 2	0.240
	CNS0095603	Golden flower (diploid) 3	0.130
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.884
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.364
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.484
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.259
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.153
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.600
	CNS0095610	Silvery flower (tetraploid) 1	0.209
	CNS0095611	Silvery flower (tetraploid) 2	0.249
	CNS0095612	Silvery flower (tetraploid) 3	0.284
	CNS0095613	Golden flower (tetraploid) 1	0.116
	CNS0095614	Golden flower (tetraploid) 2	0.108
	CNS0095615	Golden flower (tetraploid) 3	0.195
CRA001975	CRR073297	Stem 1	3.106
	CRR073298	Stem 2	4.679
	CRR073299	Stem 3	3.153
	CRR073300	Leaf 1	3.009
	CRR073301	Leaf 2	3.249
	CRR073302	Leaf 3	3.635
	CRR073303	Juvenile bud 1	0.413
	CRR073304	Juvenile bud 2	0.109
	CRR073305	Juvenile bud 3	1.201
	CRR073306	Third green 1	0.001
	CRR073307	Third green 2	0.245
	CRR073308	Third green 3	0.092
	CRR073309	Second white 1	0.188
	CRR073310	Second white 2	0.109
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.666
	CRR073316	Gold flowering 2	1.289
	CRR073317	Gold flowering 3	0.095
	CRR073318	Tawny withering 1	10.699
	CRR073319	Tawny withering 2	7.069
	CRR073320	Tawny withering 3	10.812