Gene detail

Detail information of GWHGAAZE018181

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004299508.1	4.00146E-62	PREDICTED: mitogen-activated protein kinase kinase 5-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|Q9LPQ3\|M2K7_ARATH	1E-50	Mitogen-activated protein kinase kinase 7
trEMBL	tr\|W9QZB3\|W9QZB3_9ROSA	2E-62	Mitogen-activated protein kinase kinase 4 {ECO:0000313\|EMBL:EXB45111.1}
TAIR10	AT1G18350.1	5E-42	MAP kinase kinase 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	16268754	16269113	-
GWHAAZE00000005	mRNA	16268754	16269113	-
GWHAAZE00000005	exon	16268754	16269113	-
GWHAAZE00000005	CDS	16268754	16269113	-

Transcript Sequence
>GWHTAAZE018203 ATGCGTGCAATTCATACGTCGGCACGTTGCGCGTACATGAGCCCCGAGCGATTCGACCCTGATTCATACGGAGCAAATTACAACGGGTATGCTGGGGATATATGGAGCCTGGGGTTAACGATGTTGGAATTGTATATGGGTCACTTTCCGTTCCTGCCGGCGGGTCAGAGACCCGATTGGGCGACTTTGATGTGTGCGATTTGCTTCGGAGAGCCGCCGGTTCTGCCGGAGGGAGCGTCGGAGGACTTTCGGAGTTTTATAGACTGTTGTCTGCAGAAGGATTCTACTAAGAGGTGGACGGCATCTCAGTTATTGTCGCATCCTTTTGTTGTTTGTAATAACTCCAAATCCGAACAGTGA

Network for GWHGAAZE018181

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	11	110	1.20E-14

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	STE_STE7

KEGG pathway

KO	Enzyme	pathway	mapID
K20604	MKK9	MAPK signaling pathway - plant	map04016

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	38.101
	SRR3591706	second leaf	40.987
	SRR3591707	mature leaf	44.454
	SRR3591708	Shoot apex	44.625
	SRR3591709	Stem	53.984
	SRR3591710	White floral bud	35.561
	SRR3591711	White flower	67.836
	SRR3591712	Green floral bud	30.956
	SRR3591713	Yellow flower	67.286
SRP173429	SRR8316895	Juvenile bud stage	23.285
	SRR8316896	Juvenile bud stage	27.410
	SRR8316897	Juvenile bud stage	19.225
	SRR8316894	Third green stage	9.919
	SRR8316900	Third green stage	17.555
	SRR8316901	Third green stage	25.306
	SRR8316898	Complete white stage	1.620
	SRR8316899	Complete white stage	27.670
	SRR8316903	Complete white stage	3.776
	SRR8316902	Silver flowering stage	7.478
	SRR8316904	Silver flowering stage	6.812
	SRR8316905	Silver flowering stage	9.159
	SRR8316906	Gold flowering stage	20.492
	SRR8316907	Gold flowering stage	23.445
	SRR8316908	Gold flowering stage	15.504
SRP132670	SRR6706286	Control	24.718
	SRR6706287	Light intensity 50%	27.441
	SRR6706288	Light intensity 20%	27.777
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	36.123
	CNS0095593	Slightly white alabastrum(diploid) 2	29.837
	CNS0095594	Slightly white alabastrum(diploid) 3	52.329
	CNS0095595	Whole white alabastrum(diploid) 2	17.716
	CNS0095596	Whole white alabastrum(diploid) 3	13.529
	CNS0095597	Whole white alabastrum(diploid) 4	21.476
	CNS0095598	Silvery flower (diploied) 1	55.916
	CNS0095599	Silvery flower (diploied) 2	43.081
	CNS0095600	Silvery flower (diploied) 3	31.660
	CNS0095601	Golden flower (diploid) 1	80.238
	CNS0095602	Golden flower (diploid) 2	38.382
	CNS0095603	Golden flower (diploid) 3	40.265
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.884
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.259
	CNS0095606	Slightly white alabastrum(tetraploid) 3	21.013
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.152
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.181
	CNS0095609	Whole white alabastrum(tetraploid) 3	33.852
	CNS0095610	Silvery flower (tetraploid) 1	28.850
	CNS0095611	Silvery flower (tetraploid) 2	25.911
	CNS0095612	Silvery flower (tetraploid) 3	26.619
	CNS0095613	Golden flower (tetraploid) 1	24.755
	CNS0095614	Golden flower (tetraploid) 2	20.643
	CNS0095615	Golden flower (tetraploid) 3	12.177
CRA001975	CRR073297	Stem 1	26.914
	CRR073298	Stem 2	40.419
	CRR073299	Stem 3	50.947
	CRR073300	Leaf 1	60.022
	CRR073301	Leaf 2	43.565
	CRR073302	Leaf 3	51.564
	CRR073303	Juvenile bud 1	38.076
	CRR073304	Juvenile bud 2	36.851
	CRR073305	Juvenile bud 3	49.732
	CRR073306	Third green 1	5.761
	CRR073307	Third green 2	9.302
	CRR073308	Third green 3	8.095
	CRR073309	Second white 1	3.778
	CRR073310	Second white 2	6.214
	CRR073311	Second white 3	5.261
	CRR073312	Silver flowering 1	5.820
	CRR073313	Silver flowering 2	6.324
	CRR073314	Silver flowering 3	3.262
	CRR073315	Gold flowering 1	107.935
	CRR073316	Gold flowering 2	123.405
	CRR073317	Gold flowering 3	167.558
	CRR073318	Tawny withering 1	61.074
	CRR073319	Tawny withering 2	74.716
	CRR073320	Tawny withering 3	75.192