Gene detail

Detail information of GWHGAAZE017921

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004486500.1	6.55792E-47	PREDICTED: 50S ribosomal protein L7/L12-like [Cicer arietinum]
Swissprot	tr\|Q1ACG9\|RK12_CHAVU	5E-14	50S ribosomal protein L12, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00368}
trEMBL	tr\|I1MG85\|I1MG85_SOYBN	2E-45	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA15G14280.1}
TAIR10	AT3G06040.3	4E-13	Ribosomal protein L12/ ATP-dependent Clp protease adaptor protein ClpS family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	12486102	12486395	+
GWHAAZE00000005	mRNA	12486102	12486395	+
GWHAAZE00000005	exon	12486102	12486395	+
GWHAAZE00000005	CDS	12486102	12486395	+

Transcript Sequence
>GWHTAAZE017943 ATGCAGCCAATTTCAGTAGAAGGGACGGATGTGGGTGGAGGGGCAGGTGCAGCACAGGCAGAGGAGAAGAAGGCAGAGAAAACAGCGTTTGACGTGAAGTTGGAGAAATTTGATGTGGCTGCAAAAATAAAGGTGATAAAAGAGGTAAGGGCGTTTACAAATCTGGGATTGAAGGAAGCAAAAGAGCTGGTGGAGAAGGTGCCTGTTGTACTTAAACAAGGGATTACCAAAGAGGAGGCAAGCAGCATAATAGACAAGATAAAGGCTGCTGGTGGTGTTGCTGTGATGGAGTGA

Network for GWHGAAZE017921

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00542.20	Ribosomal_L12	30	93	3.40E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02935	RP-L7, MRPL12, rplL	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.915
	SRR3591706	second leaf	21.965
	SRR3591707	mature leaf	20.451
	SRR3591708	Shoot apex	26.595
	SRR3591709	Stem	17.779
	SRR3591710	White floral bud	20.316
	SRR3591711	White flower	16.224
	SRR3591712	Green floral bud	36.808
	SRR3591713	Yellow flower	5.785
SRP173429	SRR8316895	Juvenile bud stage	16.967
	SRR8316896	Juvenile bud stage	26.961
	SRR8316897	Juvenile bud stage	11.897
	SRR8316894	Third green stage	12.565
	SRR8316900	Third green stage	43.531
	SRR8316901	Third green stage	48.983
	SRR8316898	Complete white stage	8.617
	SRR8316899	Complete white stage	45.310
	SRR8316903	Complete white stage	13.689
	SRR8316902	Silver flowering stage	4.327
	SRR8316904	Silver flowering stage	4.834
	SRR8316905	Silver flowering stage	1.895
	SRR8316906	Gold flowering stage	6.863
	SRR8316907	Gold flowering stage	12.215
	SRR8316908	Gold flowering stage	8.155
SRP132670	SRR6706286	Control	35.609
	SRR6706287	Light intensity 50%	37.836
	SRR6706288	Light intensity 20%	45.343
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	48.620
	CNS0095593	Slightly white alabastrum(diploid) 2	42.749
	CNS0095594	Slightly white alabastrum(diploid) 3	49.443
	CNS0095595	Whole white alabastrum(diploid) 2	39.965
	CNS0095596	Whole white alabastrum(diploid) 3	37.872
	CNS0095597	Whole white alabastrum(diploid) 4	36.614
	CNS0095598	Silvery flower (diploied) 1	22.777
	CNS0095599	Silvery flower (diploied) 2	20.472
	CNS0095600	Silvery flower (diploied) 3	12.359
	CNS0095601	Golden flower (diploid) 1	14.230
	CNS0095602	Golden flower (diploid) 2	12.061
	CNS0095603	Golden flower (diploid) 3	10.706
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.394
	CNS0095605	Slightly white alabastrum(tetraploid) 2	64.785
	CNS0095606	Slightly white alabastrum(tetraploid) 3	74.406
	CNS0095607	Whole white alabastrum(tetraploid) 1	39.866
	CNS0095608	Whole white alabastrum(tetraploid) 2	35.305
	CNS0095609	Whole white alabastrum(tetraploid) 3	55.818
	CNS0095610	Silvery flower (tetraploid) 1	14.755
	CNS0095611	Silvery flower (tetraploid) 2	12.767
	CNS0095612	Silvery flower (tetraploid) 3	25.005
	CNS0095613	Golden flower (tetraploid) 1	8.628
	CNS0095614	Golden flower (tetraploid) 2	17.661
	CNS0095615	Golden flower (tetraploid) 3	3.199
CRA001975	CRR073297	Stem 1	30.290
	CRR073298	Stem 2	27.462
	CRR073299	Stem 3	25.698
	CRR073300	Leaf 1	36.753
	CRR073301	Leaf 2	33.242
	CRR073302	Leaf 3	25.108
	CRR073303	Juvenile bud 1	38.162
	CRR073304	Juvenile bud 2	25.156
	CRR073305	Juvenile bud 3	38.128
	CRR073306	Third green 1	6.549
	CRR073307	Third green 2	4.888
	CRR073308	Third green 3	5.177
	CRR073309	Second white 1	6.822
	CRR073310	Second white 2	3.808
	CRR073311	Second white 3	2.295
	CRR073312	Silver flowering 1	2.267
	CRR073313	Silver flowering 2	1.912
	CRR073314	Silver flowering 3	1.287
	CRR073315	Gold flowering 1	7.606
	CRR073316	Gold flowering 2	7.388
	CRR073317	Gold flowering 3	13.367
	CRR073318	Tawny withering 1	11.885
	CRR073319	Tawny withering 2	19.384
	CRR073320	Tawny withering 3	21.793