Gene detail

Detail information of GWHGAAZE017831

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP12361.1	2.0169E-122	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9STT2\|VPS29_ARATH	1E-117	Vacuolar protein sorting-associated protein 29
trEMBL	tr\|A0A068UVB6\|A0A068UVB6_COFCA	8E-123	Coffea canephora DH200=94 genomic scaffold, scaffold_63 {ECO:0000313\|EMBL:CDP12361.1}
TAIR10	AT3G47810.3	9E-93	Calcineurin-like metallo-phosphoesterase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	11350212	11352292	+
GWHAAZE00000005	mRNA	11350212	11352292	+
GWHAAZE00000005	exon	11350212	11350343	+
GWHAAZE00000005	exon	11351062	11351199	+
GWHAAZE00000005	exon	11351996	11352292	+
GWHAAZE00000005	CDS	11350212	11350343	+
GWHAAZE00000005	CDS	11351062	11351199	+
GWHAAZE00000005	CDS	11351996	11352292	+

Transcript Sequence
>GWHTAAZE017851 ATGGTGCTGGTATTGGCATTAGGGGATCTTCACATTCCGCAAAGGGCAGCTGATCTTCCTCCCAAGTTCAAATCTATGCTTGTCCCCGGCAAGATCCAACACATCATTTGCACTGGAAATCTCTGCATCAAAGAGGTTCATGACTACTTGAGGACTATTTGCCCTGATTTACATGTTACTCGTGGTGAATATGACAAGGATAAAGGTTATCCAGAGACTAAAATTTTAACCATCGGGCAATTCAAGCTTGGCATATGCCACGGTCACCAGGTGATTCCATGGGGGGACCTGGACTCGCTAGCCATGCTCCAGCGGCAGTTGAATGTTGACATCCTTGTAACGGGGCACACCCATCAATTCACAGCCTACAAGCATGAAGCTGGGGTGGTTATAAACCCGGGATCTGCCACTGGGGCCCACAGTATCATCACCTATGATGCTAACCCGAGCTTTGTTCTCATGGACATTGACGGCCTTAGAGTGGTTGTATATGTTTATGAACTCATTGATGGAGAGGTTAAGGTTGACAAGATTGATTTCAAGAAGTCAACAGCAATTGCTCATTGA

Network for GWHGAAZE017831

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF12850.8	Metallophos_2	4	157	1.70E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K18467	VPS29	Endocytosis	map04144

Gene Ontology

GO term	Ontology	Name
GO:0042147	biological_process	retrograde transport, endosome to Golgi
GO:0030904	cellular_component	retromer complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	111.866
	SRR3591706	second leaf	50.263
	SRR3591707	mature leaf	43.024
	SRR3591708	Shoot apex	99.230
	SRR3591709	Stem	81.991
	SRR3591710	White floral bud	84.208
	SRR3591711	White flower	76.845
	SRR3591712	Green floral bud	108.638
	SRR3591713	Yellow flower	135.644
SRP173429	SRR8316895	Juvenile bud stage	52.593
	SRR8316896	Juvenile bud stage	76.286
	SRR8316897	Juvenile bud stage	31.985
	SRR8316894	Third green stage	31.729
	SRR8316900	Third green stage	129.033
	SRR8316901	Third green stage	110.863
	SRR8316898	Complete white stage	44.767
	SRR8316899	Complete white stage	134.533
	SRR8316903	Complete white stage	54.476
	SRR8316902	Silver flowering stage	34.293
	SRR8316904	Silver flowering stage	42.257
	SRR8316905	Silver flowering stage	22.959
	SRR8316906	Gold flowering stage	80.153
	SRR8316907	Gold flowering stage	89.360
	SRR8316908	Gold flowering stage	69.973
SRP132670	SRR6706286	Control	130.985
	SRR6706287	Light intensity 50%	149.545
	SRR6706288	Light intensity 20%	171.696
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	75.326
	CNS0095593	Slightly white alabastrum(diploid) 2	86.159
	CNS0095594	Slightly white alabastrum(diploid) 3	63.002
	CNS0095595	Whole white alabastrum(diploid) 2	77.519
	CNS0095596	Whole white alabastrum(diploid) 3	89.369
	CNS0095597	Whole white alabastrum(diploid) 4	66.011
	CNS0095598	Silvery flower (diploied) 1	49.630
	CNS0095599	Silvery flower (diploied) 2	57.975
	CNS0095600	Silvery flower (diploied) 3	66.102
	CNS0095601	Golden flower (diploid) 1	45.694
	CNS0095602	Golden flower (diploid) 2	79.292
	CNS0095603	Golden flower (diploid) 3	77.124
	CNS0095604	Slightly white alabastrum(tetraploid) 1	78.010
	CNS0095605	Slightly white alabastrum(tetraploid) 2	73.485
	CNS0095606	Slightly white alabastrum(tetraploid) 3	93.235
	CNS0095607	Whole white alabastrum(tetraploid) 1	59.294
	CNS0095608	Whole white alabastrum(tetraploid) 2	53.288
	CNS0095609	Whole white alabastrum(tetraploid) 3	111.564
	CNS0095610	Silvery flower (tetraploid) 1	52.459
	CNS0095611	Silvery flower (tetraploid) 2	54.623
	CNS0095612	Silvery flower (tetraploid) 3	63.197
	CNS0095613	Golden flower (tetraploid) 1	44.424
	CNS0095614	Golden flower (tetraploid) 2	52.745
	CNS0095615	Golden flower (tetraploid) 3	43.313
CRA001975	CRR073297	Stem 1	58.856
	CRR073298	Stem 2	57.864
	CRR073299	Stem 3	51.716
	CRR073300	Leaf 1	94.267
	CRR073301	Leaf 2	87.479
	CRR073302	Leaf 3	107.072
	CRR073303	Juvenile bud 1	95.297
	CRR073304	Juvenile bud 2	103.650
	CRR073305	Juvenile bud 3	45.084
	CRR073306	Third green 1	82.545
	CRR073307	Third green 2	75.227
	CRR073308	Third green 3	57.763
	CRR073309	Second white 1	50.051
	CRR073310	Second white 2	49.555
	CRR073311	Second white 3	24.993
	CRR073312	Silver flowering 1	41.561
	CRR073313	Silver flowering 2	34.414
	CRR073314	Silver flowering 3	39.559
	CRR073315	Gold flowering 1	32.176
	CRR073316	Gold flowering 2	43.575
	CRR073317	Gold flowering 3	24.012
	CRR073318	Tawny withering 1	54.501
	CRR073319	Tawny withering 2	40.036
	CRR073320	Tawny withering 3	45.492