Gene detail

Detail information of GWHGAAZE017714

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHN14082.1	1.17849E-85	Nucleoside diphosphate kinase 2, chloroplastic [Glycine soja]
Swissprot	tr\|Q852S5\|NDK2_TOBAC	2E-83	Nucleoside diphosphate kinase 2, chloroplastic (Precursor)
trEMBL	tr\|D7SHA2\|D7SHA2_VITVI	4E-84	Nucleoside diphosphate kinase {ECO:0000256\|RuleBase:RU004013}
TAIR10	AT5G63310.1	5E-59	nucleoside diphosphate kinase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	9986649	9988025	+
GWHAAZE00000005	mRNA	9986649	9988025	+
GWHAAZE00000005	exon	9986649	9986711	+
GWHAAZE00000005	exon	9986806	9986892	+
GWHAAZE00000005	exon	9987365	9987445	+
GWHAAZE00000005	exon	9987530	9987642	+
GWHAAZE00000005	exon	9987950	9988025	+
GWHAAZE00000005	CDS	9986649	9986711	+
GWHAAZE00000005	CDS	9986806	9986892	+
GWHAAZE00000005	CDS	9987365	9987445	+
GWHAAZE00000005	CDS	9987530	9987642	+
GWHAAZE00000005	CDS	9987950	9988025	+

Transcript Sequence
>GWHTAAZE017734 GCTCAGGAACAAGTGGATGAGACTTACATTATGATCAAGCCTGATGGGGTTCAACGCGGTCTCGTTGGAGAGATAATTTCAAGATTTGAAAACAAGGGTTTTAAGTTAAAAGGGTTAAAGCTCTTCCAATGCCCCAAGGATTTAGCGGAGGAGCATTATAAGGATCTCAAGTCCAAGTCCTTCTTTCCTAAATTAATCAACTACATCACCTCTGGTCCTGTCGTGTGTATGGCTTGGGAGGGAATAGGTGTTGTTGCATCAGCTCGTAAGCTAATTGGAGCGACTAATCCTCTTCAATCTGAACCGGGCACAATTAGAGGAGATCTTGCTGTTCAAACAGGAAGAAATGTAGTTCATGGGAGTGATAGCCCTGAGAATGGCAAGCGTGAAATAGGTAAATCCTCTACCATCAGCTATTGA

Network for GWHGAAZE017714

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00334.20	NDK	7	132	1.40E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00940	ndk, NME	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Purine metabolism	map00230
		Pyrimidine metabolism	map00240
		Drug metabolism - other enzymes	map00983
		MAPK signaling pathway - plant	map04016

Gene Ontology

GO term	Ontology	Name
GO:0006165	biological_process	nucleoside diphosphate phosphorylation
GO:0006183	biological_process	GTP biosynthetic process
GO:0006228	biological_process	UTP biosynthetic process
GO:0006241	biological_process	CTP biosynthetic process
GO:0004550	molecular_function	nucleoside diphosphate kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	24.110
	SRR3591706	second leaf	61.111
	SRR3591707	mature leaf	14.956
	SRR3591708	Shoot apex	53.698
	SRR3591709	Stem	16.172
	SRR3591710	White floral bud	11.362
	SRR3591711	White flower	19.411
	SRR3591712	Green floral bud	21.127
	SRR3591713	Yellow flower	8.518
SRP173429	SRR8316895	Juvenile bud stage	27.611
	SRR8316896	Juvenile bud stage	24.240
	SRR8316897	Juvenile bud stage	15.632
	SRR8316894	Third green stage	9.827
	SRR8316900	Third green stage	24.183
	SRR8316901	Third green stage	21.228
	SRR8316898	Complete white stage	4.975
	SRR8316899	Complete white stage	19.440
	SRR8316903	Complete white stage	7.643
	SRR8316902	Silver flowering stage	2.960
	SRR8316904	Silver flowering stage	2.142
	SRR8316905	Silver flowering stage	2.263
	SRR8316906	Gold flowering stage	7.322
	SRR8316907	Gold flowering stage	6.434
	SRR8316908	Gold flowering stage	6.286
SRP132670	SRR6706286	Control	17.326
	SRR6706287	Light intensity 50%	18.312
	SRR6706288	Light intensity 20%	21.935
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	30.025
	CNS0095593	Slightly white alabastrum(diploid) 2	28.634
	CNS0095594	Slightly white alabastrum(diploid) 3	17.805
	CNS0095595	Whole white alabastrum(diploid) 2	30.222
	CNS0095596	Whole white alabastrum(diploid) 3	15.062
	CNS0095597	Whole white alabastrum(diploid) 4	21.255
	CNS0095598	Silvery flower (diploied) 1	18.101
	CNS0095599	Silvery flower (diploied) 2	17.490
	CNS0095600	Silvery flower (diploied) 3	7.442
	CNS0095601	Golden flower (diploid) 1	15.168
	CNS0095602	Golden flower (diploid) 2	6.221
	CNS0095603	Golden flower (diploid) 3	8.315
	CNS0095604	Slightly white alabastrum(tetraploid) 1	20.716
	CNS0095605	Slightly white alabastrum(tetraploid) 2	21.846
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.813
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.590
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.111
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.225
	CNS0095610	Silvery flower (tetraploid) 1	7.300
	CNS0095611	Silvery flower (tetraploid) 2	10.515
	CNS0095612	Silvery flower (tetraploid) 3	6.992
	CNS0095613	Golden flower (tetraploid) 1	2.575
	CNS0095614	Golden flower (tetraploid) 2	4.302
	CNS0095615	Golden flower (tetraploid) 3	1.444
CRA001975	CRR073297	Stem 1	31.350
	CRR073298	Stem 2	31.062
	CRR073299	Stem 3	37.000
	CRR073300	Leaf 1	21.231
	CRR073301	Leaf 2	19.150
	CRR073302	Leaf 3	25.608
	CRR073303	Juvenile bud 1	18.417
	CRR073304	Juvenile bud 2	17.563
	CRR073305	Juvenile bud 3	19.744
	CRR073306	Third green 1	1.900
	CRR073307	Third green 2	2.371
	CRR073308	Third green 3	4.644
	CRR073309	Second white 1	1.859
	CRR073310	Second white 2	1.409
	CRR073311	Second white 3	0.209
	CRR073312	Silver flowering 1	1.040
	CRR073313	Silver flowering 2	0.998
	CRR073314	Silver flowering 3	0.707
	CRR073315	Gold flowering 1	28.601
	CRR073316	Gold flowering 2	34.138
	CRR073317	Gold flowering 3	17.890
	CRR073318	Tawny withering 1	19.860
	CRR073319	Tawny withering 2	26.546
	CRR073320	Tawny withering 3	35.683