Gene detail

Detail information of GWHGAAZE017642

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011083372.1	2.98706E-50	PREDICTED: long chain base biosynthesis protein 2a [Sesamum indicum]
Swissprot	tr\|Q9LSZ9\|LCB2A_ARATH	9E-47	Long chain base biosynthesis protein 2a
trEMBL	tr\|D7SH55\|D7SH55_VITVI	2E-50	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI15735.3}
TAIR10	AT5G23670.2	3E-40	long chain base2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	9097265	9101478	-
GWHAAZE00000005	mRNA	9097265	9101478	-
GWHAAZE00000005	exon	9101473	9101478	-
GWHAAZE00000005	exon	9101277	9101405	-
GWHAAZE00000005	exon	9098971	9099132	-
GWHAAZE00000005	exon	9098191	9098286	-
GWHAAZE00000005	exon	9097265	9097333	-
GWHAAZE00000005	CDS	9101473	9101478	-
GWHAAZE00000005	CDS	9101277	9101405	-
GWHAAZE00000005	CDS	9098971	9099132	-
GWHAAZE00000005	CDS	9098191	9098286	-
GWHAAZE00000005	CDS	9097265	9097333	-

Transcript Sequence
>GWHTAAZE017662 ATGGAGCCAGGCACCACAACACTGCATTCTGACTTGGAGGACTGTGTGGCAAATTTTGTTGGAAAGCCAGCTGCTTTAGTTTTTGGAATGGGCTATGTAACAAACTCTGCTATCCTTCCTGTTTTGATCGGAAAAGCATTTGTTTATTTGGATGAGGCTCATAGCATTGGAGCAGTCGGGAAAACAGGAAGGGGTGTTTGCGAGCTTTTAGGAGTGGATACAGCTGACGTGGATATCATGATGGGAACATTCACCAAGTCATTTGGATCATGTGGTGGTTATATTGCTGGATCAAAGGAACTGATTCATTACTTGAGATACACTTGTCCTGCCCATGTGTATGCCATGTCAATATCGCCTCCAGCTGCTCAACAGATTATTTCATCCATAAAGGTAATAAGCAATGTTGGTGATATGGTGGGCATAAAGTACTTCCCTGCGGAGCCAAAGAAACAGCAGTAG

Network for GWHGAAZE017642

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00155.22	Aminotran_1_2	45	140	2.60E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00654	SPT	Metabolic pathways	map01100
		Sphingolipid metabolism	map00600
		Sphingolipid signaling pathway	map04071
		Autophagy - yeast	map04138

Gene Ontology

GO term	Ontology	Name
GO:0009058	biological_process	biosynthetic process
GO:0003824	molecular_function	catalytic activity
GO:0030170	molecular_function	pyridoxal phosphate binding
GO:0016740	molecular_function	transferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.529
	SRR3591706	second leaf	0.447
	SRR3591707	mature leaf	3.274
	SRR3591708	Shoot apex	0.398
	SRR3591709	Stem	1.629
	SRR3591710	White floral bud	2.023
	SRR3591711	White flower	0.240
	SRR3591712	Green floral bud	1.256
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.932
	SRR8316896	Juvenile bud stage	1.548
	SRR8316897	Juvenile bud stage	1.073
	SRR8316894	Third green stage	0.266
	SRR8316900	Third green stage	0.865
	SRR8316901	Third green stage	0.200
	SRR8316898	Complete white stage	0.093
	SRR8316899	Complete white stage	0.366
	SRR8316903	Complete white stage	1.030
	SRR8316902	Silver flowering stage	0.130
	SRR8316904	Silver flowering stage	0.507
	SRR8316905	Silver flowering stage	0.220
	SRR8316906	Gold flowering stage	0.347
	SRR8316907	Gold flowering stage	0.017
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.720
	SRR6706287	Light intensity 50%	0.563
	SRR6706288	Light intensity 20%	0.736
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.648
	CNS0095593	Slightly white alabastrum(diploid) 2	1.365
	CNS0095594	Slightly white alabastrum(diploid) 3	1.281
	CNS0095595	Whole white alabastrum(diploid) 2	0.910
	CNS0095596	Whole white alabastrum(diploid) 3	0.437
	CNS0095597	Whole white alabastrum(diploid) 4	0.345
	CNS0095598	Silvery flower (diploied) 1	0.361
	CNS0095599	Silvery flower (diploied) 2	0.202
	CNS0095600	Silvery flower (diploied) 3	0.424
	CNS0095601	Golden flower (diploid) 1	1.115
	CNS0095602	Golden flower (diploid) 2	0.376
	CNS0095603	Golden flower (diploid) 3	0.855
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.865
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.328
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.256
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.155
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.073
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.378
	CNS0095610	Silvery flower (tetraploid) 1	0.514
	CNS0095611	Silvery flower (tetraploid) 2	0.039
	CNS0095612	Silvery flower (tetraploid) 3	0.153
	CNS0095613	Golden flower (tetraploid) 1	0.130
	CNS0095614	Golden flower (tetraploid) 2	0.155
	CNS0095615	Golden flower (tetraploid) 3	0.188
CRA001975	CRR073297	Stem 1	0.996
	CRR073298	Stem 2	0.125
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.326
	CRR073301	Leaf 2	0.205
	CRR073302	Leaf 3	0.228
	CRR073303	Juvenile bud 1	0.038
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.176
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.046
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.750
	CRR073316	Gold flowering 2	0.113
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.039
	CRR073319	Tawny withering 2	0.112
	CRR073320	Tawny withering 3	0.326