Gene detail

Detail information of GWHGAAZE017620

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010663806.1	3.60956E-47	PREDICTED: ethylene-responsive transcription factor ERF114, partial [Vitis vinifera]
Swissprot	tr\|Q9LYU3\|EF113_ARATH	7E-40	Ethylene-responsive transcription factor ERF113
trEMBL	tr\|F6GT44\|F6GT44_VITVI	2E-47	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43365.1}
TAIR10	AT5G13330.1	4E-26	related to AP2 6l

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	8676272	8678089	-
GWHAAZE00000005	mRNA	8676272	8678089	-
GWHAAZE00000005	exon	8676272	8676798	-
GWHAAZE00000005	exon	8678062	8678089	-
GWHAAZE00000005	CDS	8678062	8678089	-
GWHAAZE00000005	CDS	8676272	8676798	-

Transcript Sequence
>GWHTAAZE017640 ATGGTTTCAGCCCTTTCTCAAGTCATCGAGAACCAGATTAGAAGACATTATAGAGGAGTGAGGCAAAGACCATGGGGAAAGTGGGCTGCCGAAATCCGTGACCCGCAAAAGGCAGCTAGGGTTTGGCTCGGCACATTTGAAACCGCAGAAGCGGCAGCACTTGCATACGATGAAGCCGCTCTCAGATTCAAAGGCAACAAAGCTAAGCTCAACTTCCCCGAAAGAGTTCAAGGCCGAACCGAGCTTGGTTTTTTAACAACTCGTCCCAATTTGCGCATTCAACAACAACCACCACCACCACAGCCACCACGTCACGCACTTCCTCGGCCTCGGACTCGGCCCATTCTCTCTCAAGAAACTACTTACTCCAATATCCTTCATTATTCGTCCCAATTTGGTGAAATAAACAACTATACAACTTCATCTACATCTTCCACTGCATCTCAACAACAACAGATGTTTGATTTTCAATCGCACTTTGGGGCATCTTCTTGTAGAAGTCTTACCCCAAAAAAGGAGGATGATTTTCATGACGACAACCAGCCAGGAGATTAA

Network for GWHGAAZE017620

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	16	65	1.20E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.270
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.731
	SRR3591709	Stem	0.063
	SRR3591710	White floral bud	2.977
	SRR3591711	White flower	1.514
	SRR3591712	Green floral bud	10.609
	SRR3591713	Yellow flower	6.773
SRP173429	SRR8316895	Juvenile bud stage	4.305
	SRR8316896	Juvenile bud stage	10.706
	SRR8316897	Juvenile bud stage	3.669
	SRR8316894	Third green stage	3.807
	SRR8316900	Third green stage	6.229
	SRR8316901	Third green stage	10.730
	SRR8316898	Complete white stage	0.791
	SRR8316899	Complete white stage	1.874
	SRR8316903	Complete white stage	0.113
	SRR8316902	Silver flowering stage	0.319
	SRR8316904	Silver flowering stage	0.952
	SRR8316905	Silver flowering stage	0.169
	SRR8316906	Gold flowering stage	1.270
	SRR8316907	Gold flowering stage	0.415
	SRR8316908	Gold flowering stage	4.522
SRP132670	SRR6706286	Control	4.144
	SRR6706287	Light intensity 50%	4.011
	SRR6706288	Light intensity 20%	3.281
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.295
	CNS0095593	Slightly white alabastrum(diploid) 2	10.188
	CNS0095594	Slightly white alabastrum(diploid) 3	16.735
	CNS0095595	Whole white alabastrum(diploid) 2	15.685
	CNS0095596	Whole white alabastrum(diploid) 3	19.424
	CNS0095597	Whole white alabastrum(diploid) 4	13.666
	CNS0095598	Silvery flower (diploied) 1	1.387
	CNS0095599	Silvery flower (diploied) 2	0.786
	CNS0095600	Silvery flower (diploied) 3	0.551
	CNS0095601	Golden flower (diploid) 1	0.403
	CNS0095602	Golden flower (diploid) 2	2.343
	CNS0095603	Golden flower (diploid) 3	1.383
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.653
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.803
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.174
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.991
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.815
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.664
	CNS0095610	Silvery flower (tetraploid) 1	0.748
	CNS0095611	Silvery flower (tetraploid) 2	0.115
	CNS0095612	Silvery flower (tetraploid) 3	0.762
	CNS0095613	Golden flower (tetraploid) 1	3.495
	CNS0095614	Golden flower (tetraploid) 2	3.267
	CNS0095615	Golden flower (tetraploid) 3	1.672
CRA001975	CRR073297	Stem 1	3.797
	CRR073298	Stem 2	4.629
	CRR073299	Stem 3	1.648
	CRR073300	Leaf 1	6.028
	CRR073301	Leaf 2	6.440
	CRR073302	Leaf 3	3.518
	CRR073303	Juvenile bud 1	1.474
	CRR073304	Juvenile bud 2	0.393
	CRR073305	Juvenile bud 3	0.760
	CRR073306	Third green 1	0.902
	CRR073307	Third green 2	0.678
	CRR073308	Third green 3	0.291
	CRR073309	Second white 1	0.218
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.851
	CRR073313	Silver flowering 2	0.196
	CRR073314	Silver flowering 3	0.330
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.258
	CRR073317	Gold flowering 3	0.091
	CRR073318	Tawny withering 1	2.378
	CRR073319	Tawny withering 2	2.534
	CRR073320	Tawny withering 3	2.975