Gene detail

Detail information of GWHGAAZE017550

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008377674.1	4.31086E-67	PREDICTED: ethylene-responsive transcription factor ERF003-like [Malus domestica]
Swissprot	tr\|Q94AW5\|ERF03_ARATH	2E-63	Ethylene-responsive transcription factor ERF003
trEMBL	tr\|D5L105\|D5L105_MALDO	2E-67	AP2 domain class transcription factor {ECO:0000313\|EMBL:ADE41114.1}
TAIR10	AT5G25190.1	1E-23	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	7830409	7830964	-
GWHAAZE00000005	mRNA	7830409	7830964	-
GWHAAZE00000005	exon	7830409	7830787	-
GWHAAZE00000005	exon	7830882	7830964	-
GWHAAZE00000005	CDS	7830882	7830964	-
GWHAAZE00000005	CDS	7830409	7830787	-

Transcript Sequence
>GWHTAAZE017570 ATGGCTAGGCGTCAACAGCGATACAGAGGAGTTCGCCAGCGCCACTGGGGCTCTTGGGTCTCCGAAATTCGCCACCCTCTCCTGAAGACTAGAATTTGGCTAGGTACATACGAGACAGCTGAGGATGCAGCACGGGCGTACGATGAAGCGGCGAGGCTAATGTGCGGTCCAAGAACGCGCATGAATTTTGCTTACAATCCCATTTCATCTTCTTCTTCAACAAAGCTTCTCTCTGCTACTTTGACAGCTAAATTACAGAGATGCCACATGGAGTCTCTCCAAAAGGCCAAGAAAACTGTGACGAAAGATGCTCAAAGGAATATTAAGGGTGGAAGTGCGGGCAAAATGGGGAGCGGTGATCAACAGTTAATCAAGACTCTTGAAGATGATCATATAGAGCAAATGATAGACGAGTTGCTTGATTATGGGTCTATTGAGCTCTCTCCTGTTCTTCAAAACTAG

Network for GWHGAAZE017550

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	7	56	3.50E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.200
	SRR3591706	second leaf	0.116
	SRR3591707	mature leaf	1.343
	SRR3591708	Shoot apex	1.254
	SRR3591709	Stem	2.748
	SRR3591710	White floral bud	0.575
	SRR3591711	White flower	0.640
	SRR3591712	Green floral bud	1.229
	SRR3591713	Yellow flower	0.173
SRP173429	SRR8316895	Juvenile bud stage	0.926
	SRR8316896	Juvenile bud stage	0.692
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.142
	SRR8316900	Third green stage	1.388
	SRR8316901	Third green stage	1.473
	SRR8316898	Complete white stage	0.053
	SRR8316899	Complete white stage	0.278
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.166
	SRR8316904	Silver flowering stage	0.148
	SRR8316905	Silver flowering stage	0.099
	SRR8316906	Gold flowering stage	0.268
	SRR8316907	Gold flowering stage	0.581
	SRR8316908	Gold flowering stage	0.576
SRP132670	SRR6706286	Control	1.670
	SRR6706287	Light intensity 50%	2.372
	SRR6706288	Light intensity 20%	1.779
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.566
	CNS0095593	Slightly white alabastrum(diploid) 2	0.358
	CNS0095594	Slightly white alabastrum(diploid) 3	1.232
	CNS0095595	Whole white alabastrum(diploid) 2	0.596
	CNS0095596	Whole white alabastrum(diploid) 3	0.955
	CNS0095597	Whole white alabastrum(diploid) 4	0.102
	CNS0095598	Silvery flower (diploied) 1	0.652
	CNS0095599	Silvery flower (diploied) 2	0.714
	CNS0095600	Silvery flower (diploied) 3	0.065
	CNS0095601	Golden flower (diploid) 1	0.872
	CNS0095602	Golden flower (diploid) 2	0.639
	CNS0095603	Golden flower (diploid) 3	0.472
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.041
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.364
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.736
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.130
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.280
	CNS0095610	Silvery flower (tetraploid) 1	0.564
	CNS0095611	Silvery flower (tetraploid) 2	0.638
	CNS0095612	Silvery flower (tetraploid) 3	0.352
	CNS0095613	Golden flower (tetraploid) 1	0.840
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.123
CRA001975	CRR073297	Stem 1	2.259
	CRR073298	Stem 2	1.260
	CRR073299	Stem 3	4.213
	CRR073300	Leaf 1	1.229
	CRR073301	Leaf 2	0.394
	CRR073302	Leaf 3	1.299
	CRR073303	Juvenile bud 1	0.869
	CRR073304	Juvenile bud 2	0.471
	CRR073305	Juvenile bud 3	0.931
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.012
	CRR073308	Third green 3	0.108
	CRR073309	Second white 1	1.652
	CRR073310	Second white 2	0.485
	CRR073311	Second white 3	0.230
	CRR073312	Silver flowering 1	0.068
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.813
	CRR073316	Gold flowering 2	1.574
	CRR073317	Gold flowering 3	3.034
	CRR073318	Tawny withering 1	1.534
	CRR073319	Tawny withering 2	0.843
	CRR073320	Tawny withering 3	0.560