Gene detail

Detail information of GWHGAAZE017467

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010254303.1	4.78481E-82	PREDICTED: probable histone H2A variant 3 [Nelumbo nucifera]
Swissprot	tr\|Q9C944\|H2AV3_ARATH	2E-75	Probable histone H2A variant 3
trEMBL	tr\|D7SUM0\|D7SUM0_VITVI	6E-82	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT1G52740.1	7E-59	histone H2A protein 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000005	gene	6714087	6715464	-
GWHAAZE00000005	mRNA	6714087	6715464	-
GWHAAZE00000005	exon	6714087	6714383	-
GWHAAZE00000005	exon	6715345	6715464	-
GWHAAZE00000005	CDS	6715345	6715464	-
GWHAAZE00000005	CDS	6714087	6714383	-

Transcript Sequence
>GWHTAAZE017487 ATGTCGGGGAAAGGTGCAAAGGGCCTTATAATGGGGAAGTCTTCTTCGGCTGCCCTAAACAACAACAAGGATAAGGACAAGAAGAAGGCCGTCTCTCGCTCTTCTCGTGCTGGTCTTCAGTTCCCAGTGGGCCGAGTTCACCGTCTATTGAAGACGAGGGTTTCTGCTAATGGAAGGGTTGGAGCAACCGCTGCTGTTTATACAGCAGCAATACTCGAGTATCTGACTGCAGAGGTGCTGGAGCTGGCAGGCAATGCAAGCAAGGACCTGAAAGTAAAGCGTATTACGCCAAGACACTTGCAGCTCGCCATCCGTGGGGATGAAGAACTAGACACCCTCATCAAAGGAACTATAGCCGGTGGAGGGGTTATACCCCACATCCACAAGTCACTCATCAACAAGTCTTCCAAGGAGTAG

Network for GWHGAAZE017467

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	13	107	1.50E-19
PF16211.6	Histone_H2A_C	108	137	8.70E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	47.202
	SRR3591706	second leaf	31.994
	SRR3591707	mature leaf	51.979
	SRR3591708	Shoot apex	45.574
	SRR3591709	Stem	60.288
	SRR3591710	White floral bud	58.594
	SRR3591711	White flower	67.876
	SRR3591712	Green floral bud	58.046
	SRR3591713	Yellow flower	70.064
SRP173429	SRR8316895	Juvenile bud stage	26.160
	SRR8316896	Juvenile bud stage	36.588
	SRR8316897	Juvenile bud stage	19.449
	SRR8316894	Third green stage	16.262
	SRR8316900	Third green stage	62.228
	SRR8316901	Third green stage	68.075
	SRR8316898	Complete white stage	28.636
	SRR8316899	Complete white stage	75.143
	SRR8316903	Complete white stage	32.206
	SRR8316902	Silver flowering stage	27.898
	SRR8316904	Silver flowering stage	30.830
	SRR8316905	Silver flowering stage	19.600
	SRR8316906	Gold flowering stage	107.761
	SRR8316907	Gold flowering stage	105.931
	SRR8316908	Gold flowering stage	82.609
SRP132670	SRR6706286	Control	70.611
	SRR6706287	Light intensity 50%	73.811
	SRR6706288	Light intensity 20%	73.950
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	70.290
	CNS0095593	Slightly white alabastrum(diploid) 2	79.118
	CNS0095594	Slightly white alabastrum(diploid) 3	71.802
	CNS0095595	Whole white alabastrum(diploid) 2	87.887
	CNS0095596	Whole white alabastrum(diploid) 3	72.140
	CNS0095597	Whole white alabastrum(diploid) 4	80.944
	CNS0095598	Silvery flower (diploied) 1	62.733
	CNS0095599	Silvery flower (diploied) 2	58.254
	CNS0095600	Silvery flower (diploied) 3	51.036
	CNS0095601	Golden flower (diploid) 1	73.932
	CNS0095602	Golden flower (diploid) 2	57.184
	CNS0095603	Golden flower (diploid) 3	51.828
	CNS0095604	Slightly white alabastrum(tetraploid) 1	67.599
	CNS0095605	Slightly white alabastrum(tetraploid) 2	83.489
	CNS0095606	Slightly white alabastrum(tetraploid) 3	53.783
	CNS0095607	Whole white alabastrum(tetraploid) 1	77.142
	CNS0095608	Whole white alabastrum(tetraploid) 2	80.251
	CNS0095609	Whole white alabastrum(tetraploid) 3	69.295
	CNS0095610	Silvery flower (tetraploid) 1	68.533
	CNS0095611	Silvery flower (tetraploid) 2	45.021
	CNS0095612	Silvery flower (tetraploid) 3	50.035
	CNS0095613	Golden flower (tetraploid) 1	84.852
	CNS0095614	Golden flower (tetraploid) 2	71.797
	CNS0095615	Golden flower (tetraploid) 3	50.678
CRA001975	CRR073297	Stem 1	52.619
	CRR073298	Stem 2	51.637
	CRR073299	Stem 3	52.428
	CRR073300	Leaf 1	63.040
	CRR073301	Leaf 2	66.372
	CRR073302	Leaf 3	70.401
	CRR073303	Juvenile bud 1	71.380
	CRR073304	Juvenile bud 2	84.344
	CRR073305	Juvenile bud 3	57.087
	CRR073306	Third green 1	59.524
	CRR073307	Third green 2	54.858
	CRR073308	Third green 3	50.202
	CRR073309	Second white 1	57.444
	CRR073310	Second white 2	44.340
	CRR073311	Second white 3	42.134
	CRR073312	Silver flowering 1	49.948
	CRR073313	Silver flowering 2	63.417
	CRR073314	Silver flowering 3	61.090
	CRR073315	Gold flowering 1	89.142
	CRR073316	Gold flowering 2	55.245
	CRR073317	Gold flowering 3	62.956
	CRR073318	Tawny withering 1	48.099
	CRR073319	Tawny withering 2	56.068
	CRR073320	Tawny withering 3	49.221