Gene detail

Detail information of GWHGAAZE017102

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007012585.1	1.80681E-44	Integrase-type DNA-binding superfamily protein, putative [Theobroma cacao]
Swissprot	tr\|Q9C591\|ERF16_ARATH	1E-34	Ethylene-responsive transcription factor ERF016
trEMBL	tr\|A0A061GSY0\|A0A061GSY0_THECC	7E-45	Integrase-type DNA-binding superfamily protein, putative {ECO:0000313\|EMBL:EOY30204.1}
TAIR10	AT5G21960.1	9E-22	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	91714062	91714526	-
GWHAAZE00000004	mRNA	91714062	91714526	-
GWHAAZE00000004	exon	91714062	91714526	-
GWHAAZE00000004	CDS	91714062	91714526	-

Transcript Sequence
>GWHTAAZE017122 ATGAAAATGGTGAGGCCAACTGCAAGTAGAAGAGAGACAAGTAACGGAATTACTAACGGCCGTTACAAGGGCGTGAGGATGAGAAAATGGGGAAAGTGGGTAGCGGAGGTACGGCAACCCAACAGCCGTCACAGAATCTGGTTAGGTTCGTACACGAAGGCCGAGGAGGCTGCTAGAGCCTACGACGCCGCTGCCTACTGCCTACGAGGACCCGAGGCGGTTCTTAATTTCCCCGAGAATCCTCCGCCGGTGGTTGCTTGGGCGAATGAGTTGTCGCCCAAGCAGATTCAGGTGGCGGCATCCCGGCACGCCCACCAGGAGGTTGCGCCACCAGTGAGGGAGTCTCCGTTCGGTGAGCTGTCGGCGGACGAGGGTTATTATGCGCCGGTGCAGGGGAGAGGCGGTGAGGAGAGTGTGGCAGGTGGTGCTTTTTTCGAGGCACCACGTGTGTGGACATTTTACTAG

Network for GWHGAAZE017102

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	21	70	3.50E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.916
	SRR3591706	second leaf	1.879
	SRR3591707	mature leaf	1.810
	SRR3591708	Shoot apex	3.054
	SRR3591709	Stem	3.094
	SRR3591710	White floral bud	8.159
	SRR3591711	White flower	38.723
	SRR3591712	Green floral bud	1.452
	SRR3591713	Yellow flower	123.841
SRP173429	SRR8316895	Juvenile bud stage	6.140
	SRR8316896	Juvenile bud stage	4.211
	SRR8316897	Juvenile bud stage	11.445
	SRR8316894	Third green stage	0.146
	SRR8316900	Third green stage	0.190
	SRR8316901	Third green stage	0.844
	SRR8316898	Complete white stage	0.459
	SRR8316899	Complete white stage	1.989
	SRR8316903	Complete white stage	0.750
	SRR8316902	Silver flowering stage	8.488
	SRR8316904	Silver flowering stage	4.955
	SRR8316905	Silver flowering stage	4.709
	SRR8316906	Gold flowering stage	26.971
	SRR8316907	Gold flowering stage	27.623
	SRR8316908	Gold flowering stage	22.383
SRP132670	SRR6706286	Control	0.437
	SRR6706287	Light intensity 50%	0.460
	SRR6706288	Light intensity 20%	0.339
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.318
	CNS0095593	Slightly white alabastrum(diploid) 2	8.093
	CNS0095594	Slightly white alabastrum(diploid) 3	4.130
	CNS0095595	Whole white alabastrum(diploid) 2	9.081
	CNS0095596	Whole white alabastrum(diploid) 3	1.298
	CNS0095597	Whole white alabastrum(diploid) 4	2.412
	CNS0095598	Silvery flower (diploied) 1	13.311
	CNS0095599	Silvery flower (diploied) 2	37.700
	CNS0095600	Silvery flower (diploied) 3	15.833
	CNS0095601	Golden flower (diploid) 1	33.902
	CNS0095602	Golden flower (diploid) 2	40.314
	CNS0095603	Golden flower (diploid) 3	41.883
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.082
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	2.656
	CNS0095611	Silvery flower (tetraploid) 2	0.540
	CNS0095612	Silvery flower (tetraploid) 3	4.961
	CNS0095613	Golden flower (tetraploid) 1	12.637
	CNS0095614	Golden flower (tetraploid) 2	4.383
	CNS0095615	Golden flower (tetraploid) 3	33.841
CRA001975	CRR073297	Stem 1	1.985
	CRR073298	Stem 2	3.186
	CRR073299	Stem 3	1.270
	CRR073300	Leaf 1	3.070
	CRR073301	Leaf 2	5.943
	CRR073302	Leaf 3	1.563
	CRR073303	Juvenile bud 1	1.396
	CRR073304	Juvenile bud 2	2.304
	CRR073305	Juvenile bud 3	1.906
	CRR073306	Third green 1	10.483
	CRR073307	Third green 2	15.498
	CRR073308	Third green 3	7.625
	CRR073309	Second white 1	71.743
	CRR073310	Second white 2	66.481
	CRR073311	Second white 3	56.216
	CRR073312	Silver flowering 1	166.486
	CRR073313	Silver flowering 2	185.421
	CRR073314	Silver flowering 3	160.320
	CRR073315	Gold flowering 1	3.104
	CRR073316	Gold flowering 2	4.726
	CRR073317	Gold flowering 3	0.404
	CRR073318	Tawny withering 1	3.463
	CRR073319	Tawny withering 2	12.395
	CRR073320	Tawny withering 3	0.777