Gene detail

Detail information of GWHGAAZE017001

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011090548.1	7.26523E-79	PREDICTED: uncharacterized protein LOC105171211 [Sesamum indicum]
trEMBL	tr\|A0A022QQP7\|A0A022QQP7_ERYGU	2E-76	Uncharacterized protein {ECO:0000313\|EMBL:EYU31012.1}
TAIR10	AT4G39880.1	7E-49	Ribosomal protein L23/L15e family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	89165420	89166635	+
GWHAAZE00000004	mRNA	89165420	89166635	+
GWHAAZE00000004	exon	89165420	89165541	+
GWHAAZE00000004	exon	89165662	89165683	+
GWHAAZE00000004	exon	89166168	89166635	+
GWHAAZE00000004	CDS	89165420	89165541	+
GWHAAZE00000004	CDS	89165662	89165683	+
GWHAAZE00000004	CDS	89166168	89166635	+

Transcript Sequence
>GWHTAAZE017021 ATGGGCAGTAGATTGGGAAGAAGAGTAGTACACTTCGCTAACCTCCCCATCAAGCTCCTTATGCCCTCTTCTTTCACCAACATCACTGAAATTGCTCTCAAAACCATCCCTCTGCTACCAAGATTGAAATCAAGTGGTGTTTATATCGAAATCAAGCGATGCTTGGAGTGTCTCTATGGATTTGAAGTCGAAAAGGTCGAAACGCTAAACATGGACGGCAAGAAGAAGAAGAGGGGCGGGCTATTGATTGCAAAGCCCGATTACAAAAAGGCCTACGTCACTTTGAGGAACCCTTTGTCTCTATCCCCAGACCTTTATCCGATCCGAGTAATTGAGGAGGAGAGGAGGAATTTGACTAAGCAGTCAAAATCGAGCTTTGTGGAGAATGGGGAAGTGAAGAAATCGCATTGGCTTGATAACAAGGATGGTGCCAAATCAAGGCCTGAGAAAATTAATAGTGGTGCTGGTGGCGCTGGACCATATAATAGGGATGGTGGTAGGTTTAAGACGGAGAAAAGGTATGTTGGTGGTCGTGGCAGAGATGGTGGTGGTGGTGCTGGAACAACGGTGAAGTTTCCATGGAGCAGTATGCGTTCTTCTTCCTCTAGTTAG

Network for GWHGAAZE017001

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00276.21	Ribosomal_L23	49	96	2.30E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02892	RP-L23, MRPL23, rplW	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.130
	SRR3591706	second leaf	19.918
	SRR3591707	mature leaf	21.958
	SRR3591708	Shoot apex	37.865
	SRR3591709	Stem	29.002
	SRR3591710	White floral bud	25.190
	SRR3591711	White flower	32.866
	SRR3591712	Green floral bud	41.052
	SRR3591713	Yellow flower	36.740
SRP173429	SRR8316895	Juvenile bud stage	31.986
	SRR8316896	Juvenile bud stage	38.782
	SRR8316897	Juvenile bud stage	20.202
	SRR8316894	Third green stage	14.457
	SRR8316900	Third green stage	37.634
	SRR8316901	Third green stage	34.845
	SRR8316898	Complete white stage	10.474
	SRR8316899	Complete white stage	35.512
	SRR8316903	Complete white stage	14.589
	SRR8316902	Silver flowering stage	12.424
	SRR8316904	Silver flowering stage	13.095
	SRR8316905	Silver flowering stage	7.948
	SRR8316906	Gold flowering stage	15.735
	SRR8316907	Gold flowering stage	18.750
	SRR8316908	Gold flowering stage	26.233
SRP132670	SRR6706286	Control	38.550
	SRR6706287	Light intensity 50%	39.584
	SRR6706288	Light intensity 20%	44.873
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	38.458
	CNS0095593	Slightly white alabastrum(diploid) 2	32.338
	CNS0095594	Slightly white alabastrum(diploid) 3	39.402
	CNS0095595	Whole white alabastrum(diploid) 2	27.870
	CNS0095596	Whole white alabastrum(diploid) 3	23.957
	CNS0095597	Whole white alabastrum(diploid) 4	20.599
	CNS0095598	Silvery flower (diploied) 1	27.202
	CNS0095599	Silvery flower (diploied) 2	19.611
	CNS0095600	Silvery flower (diploied) 3	22.772
	CNS0095601	Golden flower (diploid) 1	18.567
	CNS0095602	Golden flower (diploid) 2	21.232
	CNS0095603	Golden flower (diploid) 3	19.672
	CNS0095604	Slightly white alabastrum(tetraploid) 1	34.214
	CNS0095605	Slightly white alabastrum(tetraploid) 2	31.457
	CNS0095606	Slightly white alabastrum(tetraploid) 3	43.806
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.181
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.154
	CNS0095609	Whole white alabastrum(tetraploid) 3	30.298
	CNS0095610	Silvery flower (tetraploid) 1	26.624
	CNS0095611	Silvery flower (tetraploid) 2	25.406
	CNS0095612	Silvery flower (tetraploid) 3	14.864
	CNS0095613	Golden flower (tetraploid) 1	15.588
	CNS0095614	Golden flower (tetraploid) 2	24.982
	CNS0095615	Golden flower (tetraploid) 3	13.603
CRA001975	CRR073297	Stem 1	37.706
	CRR073298	Stem 2	35.857
	CRR073299	Stem 3	38.041
	CRR073300	Leaf 1	30.398
	CRR073301	Leaf 2	35.199
	CRR073302	Leaf 3	41.611
	CRR073303	Juvenile bud 1	44.537
	CRR073304	Juvenile bud 2	28.377
	CRR073305	Juvenile bud 3	27.428
	CRR073306	Third green 1	7.653
	CRR073307	Third green 2	6.112
	CRR073308	Third green 3	7.644
	CRR073309	Second white 1	8.275
	CRR073310	Second white 2	10.981
	CRR073311	Second white 3	6.254
	CRR073312	Silver flowering 1	3.124
	CRR073313	Silver flowering 2	2.431
	CRR073314	Silver flowering 3	5.474
	CRR073315	Gold flowering 1	13.728
	CRR073316	Gold flowering 2	14.201
	CRR073317	Gold flowering 3	9.644
	CRR073318	Tawny withering 1	40.037
	CRR073319	Tawny withering 2	33.622
	CRR073320	Tawny withering 3	38.681