Gene detail

Detail information of GWHGAAZE016918

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010096464.1	1.51642E-43	Ethylene-responsive transcription factor [Morus notabilis]
Swissprot	tr\|P93007\|EF112_ARATH	4E-31	Ethylene-responsive transcription factor ERF112
trEMBL	tr\|W9RA19\|W9RA19_9ROSA	6E-44	Ethylene-responsive transcription factor {ECO:0000313\|EMBL:EXB64474.1}
TAIR10	AT2G33710.2	6E-26	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	85942458	85942955	+
GWHAAZE00000004	mRNA	85942458	85942955	+
GWHAAZE00000004	exon	85942458	85942955	+
GWHAAZE00000004	CDS	85942458	85942955	+

Transcript Sequence
>GWHTAAZE016938 ACTCCAACATATGAACAAAGTACAGCAGAGAGAAGATACAGAGGAGTGAGAAAAAGGCCATGGGGCAAATGGGCAGCTGAAATTAGGGACCCAAACAAGGCCTCTAGGGTTTGGTTAGGCACTTTTCATACCCCTGAGGCTGCTGCTAGGGCTTATGATCAAGCTGCTCTCAATTTCAGAGGGAACAGAGCCAAACTCAACTTCCCTGAGAATGTCAATCTCAGGCCACCTCCGGCTAATTCTCCGGCTACCCCGTTGCTTGTTTCGGATTCTACATATACCCTTTTAACGGATTCTGCATCAACTCAGCCTAAGAGTTTGTCGGATGAGTTTCTACATTCAATGGATTCTAGCTTCACATCATCTTCCTCCTCGTATCCTCTGCTTTTTGCCCATCAACCATTGGTTCAGGTTAGGCCAGTGGCTACTCGGGGCAGTGGTGTGGATTTTCCGGTGACACCGTGGCCAGATTCCAGTCACCAACCACCTTCAAAATAG

Network for GWHGAAZE016918

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	12	61	6.10E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.884
	SRR3591706	second leaf	0.937
	SRR3591707	mature leaf	0.287
	SRR3591708	Shoot apex	1.190
	SRR3591709	Stem	2.407
	SRR3591710	White floral bud	0.167
	SRR3591711	White flower	1.562
	SRR3591712	Green floral bud	0.259
	SRR3591713	Yellow flower	10.082
SRP173429	SRR8316895	Juvenile bud stage	0.288
	SRR8316896	Juvenile bud stage	0.600
	SRR8316897	Juvenile bud stage	0.374
	SRR8316894	Third green stage	0.136
	SRR8316900	Third green stage	0.442
	SRR8316901	Third green stage	0.458
	SRR8316898	Complete white stage	0.444
	SRR8316899	Complete white stage	0.518
	SRR8316903	Complete white stage	0.103
	SRR8316902	Silver flowering stage	1.402
	SRR8316904	Silver flowering stage	1.690
	SRR8316905	Silver flowering stage	0.631
	SRR8316906	Gold flowering stage	25.865
	SRR8316907	Gold flowering stage	5.368
	SRR8316908	Gold flowering stage	7.538
SRP132670	SRR6706286	Control	0.156
	SRR6706287	Light intensity 50%	0.085
	SRR6706288	Light intensity 20%	0.125
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.396
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.071
	CNS0095596	Whole white alabastrum(diploid) 3	0.197
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.247
	CNS0095599	Silvery flower (diploied) 2	0.300
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	1.506
	CNS0095602	Golden flower (diploid) 2	1.513
	CNS0095603	Golden flower (diploid) 3	1.893
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.137
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.195
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.064
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.069
	CNS0095610	Silvery flower (tetraploid) 1	0.414
	CNS0095611	Silvery flower (tetraploid) 2	0.257
	CNS0095612	Silvery flower (tetraploid) 3	0.286
	CNS0095613	Golden flower (tetraploid) 1	0.567
	CNS0095614	Golden flower (tetraploid) 2	0.736
	CNS0095615	Golden flower (tetraploid) 3	0.054
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.429
	CRR073300	Leaf 1	0.370
	CRR073301	Leaf 2	0.422
	CRR073302	Leaf 3	0.001
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.250
	CRR073305	Juvenile bud 3	0.107
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.312
	CRR073308	Third green 3	0.095
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.028
	CRR073311	Second white 3	0.716
	CRR073312	Silver flowering 1	1.748
	CRR073313	Silver flowering 2	1.670
	CRR073314	Silver flowering 3	2.239
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.142
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.032