Gene detail

Detail information of GWHGAAZE016790

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN68041.1	7.01794E-29	hypothetical protein VITISV_039275 [Vitis vinifera]
Swissprot	tr\|Q336M2\|CDKE1_ORYSJ	6E-29	Cyclin-dependent kinase E-1
trEMBL	tr\|A5BKP3\|A5BKP3_VITVI	3E-29	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN68041.1}
TAIR10	AT5G63610.1	1E-23	cyclin-dependent kinase E;1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	82986495	82990416	-
GWHAAZE00000004	mRNA	82986495	82990416	-
GWHAAZE00000004	exon	82990384	82990416	-
GWHAAZE00000004	exon	82988133	82988243	-
GWHAAZE00000004	exon	82986495	82986590	-
GWHAAZE00000004	CDS	82990384	82990416	-
GWHAAZE00000004	CDS	82988133	82988243	-
GWHAAZE00000004	CDS	82986495	82986590	-

Transcript Sequence
>GWHTAAZE016810 ATGCCTTGCTACAGTACAAAAAGGCCATCTTTGGTAATGGGTGAGGGAGAGGAACAAGGAGTTGTTAAAATTGCTGATTTTGGACTTGCAAGAATCTACCAAGCTCCACTGAAGCCGCTATCTGAAAATGGGGTAGAACATCTTGTTGTGGTAACCATTTGGTATCGTGCACCTGAGTTACTTCTTGGGGCGAAACACTATACTAGTGCTGTTGGTATAATCCCTTTGTACCAGATTTAG

Network for GWHGAAZE016790

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	18	71	3.10E-09

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CMGC_CDK-CDK8

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.431
	SRR3591706	second leaf	5.847
	SRR3591707	mature leaf	8.326
	SRR3591708	Shoot apex	14.497
	SRR3591709	Stem	14.616
	SRR3591710	White floral bud	13.620
	SRR3591711	White flower	19.699
	SRR3591712	Green floral bud	14.898
	SRR3591713	Yellow flower	21.727
SRP173429	SRR8316895	Juvenile bud stage	7.054
	SRR8316896	Juvenile bud stage	8.817
	SRR8316897	Juvenile bud stage	2.856
	SRR8316894	Third green stage	4.609
	SRR8316900	Third green stage	15.449
	SRR8316901	Third green stage	14.085
	SRR8316898	Complete white stage	4.678
	SRR8316899	Complete white stage	14.229
	SRR8316903	Complete white stage	8.974
	SRR8316902	Silver flowering stage	5.012
	SRR8316904	Silver flowering stage	13.615
	SRR8316905	Silver flowering stage	5.442
	SRR8316906	Gold flowering stage	20.404
	SRR8316907	Gold flowering stage	18.719
	SRR8316908	Gold flowering stage	23.903
SRP132670	SRR6706286	Control	7.666
	SRR6706287	Light intensity 50%	10.921
	SRR6706288	Light intensity 20%	10.552
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.004
	CNS0095593	Slightly white alabastrum(diploid) 2	5.485
	CNS0095594	Slightly white alabastrum(diploid) 3	5.907
	CNS0095595	Whole white alabastrum(diploid) 2	12.508
	CNS0095596	Whole white alabastrum(diploid) 3	6.007
	CNS0095597	Whole white alabastrum(diploid) 4	10.406
	CNS0095598	Silvery flower (diploied) 1	3.636
	CNS0095599	Silvery flower (diploied) 2	9.632
	CNS0095600	Silvery flower (diploied) 3	11.047
	CNS0095601	Golden flower (diploid) 1	6.526
	CNS0095602	Golden flower (diploid) 2	9.460
	CNS0095603	Golden flower (diploid) 3	12.706
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.374
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.618
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.463
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.578
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.731
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.777
	CNS0095610	Silvery flower (tetraploid) 1	12.240
	CNS0095611	Silvery flower (tetraploid) 2	13.777
	CNS0095612	Silvery flower (tetraploid) 3	11.204
	CNS0095613	Golden flower (tetraploid) 1	6.700
	CNS0095614	Golden flower (tetraploid) 2	9.026
	CNS0095615	Golden flower (tetraploid) 3	8.987
CRA001975	CRR073297	Stem 1	15.751
	CRR073298	Stem 2	13.548
	CRR073299	Stem 3	14.668
	CRR073300	Leaf 1	15.382
	CRR073301	Leaf 2	15.655
	CRR073302	Leaf 3	19.076
	CRR073303	Juvenile bud 1	22.884
	CRR073304	Juvenile bud 2	12.869
	CRR073305	Juvenile bud 3	20.819
	CRR073306	Third green 1	7.500
	CRR073307	Third green 2	8.401
	CRR073308	Third green 3	7.312
	CRR073309	Second white 1	12.967
	CRR073310	Second white 2	15.516
	CRR073311	Second white 3	18.036
	CRR073312	Silver flowering 1	11.440
	CRR073313	Silver flowering 2	12.224
	CRR073314	Silver flowering 3	9.352
	CRR073315	Gold flowering 1	9.504
	CRR073316	Gold flowering 2	12.385
	CRR073317	Gold flowering 3	9.168
	CRR073318	Tawny withering 1	8.890
	CRR073319	Tawny withering 2	12.635
	CRR073320	Tawny withering 3	16.094