Gene detail

Detail information of GWHGAAZE016597

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002278300.1	2.08363E-38	PREDICTED: cytochrome P450 71A1 [Vitis vinifera]
Swissprot	tr\|O65782\|C83B1_ARATH	4E-22	Cytochrome P450 83B1
trEMBL	tr\|F6H064\|F6H064_VITVI	8E-39	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB46012.1}
TAIR10	AT4G31500.1	2E-13	cytochrome P450, family 83, subfamily B, polypeptide 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	79360098	79360388	-
GWHAAZE00000004	mRNA	79360098	79360388	-
GWHAAZE00000004	exon	79360098	79360388	-
GWHAAZE00000004	CDS	79360098	79360388	-

Transcript Sequence
>GWHTAAZE016617 ATGAAAAAGATTGTCACTCTTCATTTGTTTAGCTCTAAAAGAGTTCAATATTTTCGTCCTATTCGAGAAGATGAAGTTTGTCGAATGATAAAAAAAGTATCTGAACTCGCAGCTTCATCTAAAATCGCCAATTTGAGTGAATTAATATTGTCTCTCACAAGCATTATAATATGTAGAGTTGCTTTTAGTAAGCGGTTTGACGAAGGTTATGAAGGGAGTAGATTCCATCGGTTTGTTACAGAATGCCAGGCCGTGATGGTGAGCTTTTATTTTTCTGATCATTTTCCATTG

Network for GWHGAAZE016597

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	2	87	1.40E-05

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	39.313
	SRR3591706	second leaf	22.089
	SRR3591707	mature leaf	21.518
	SRR3591708	Shoot apex	18.508
	SRR3591709	Stem	27.115
	SRR3591710	White floral bud	5.921
	SRR3591711	White flower	2.175
	SRR3591712	Green floral bud	6.384
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	10.226
	SRR8316896	Juvenile bud stage	9.952
	SRR8316897	Juvenile bud stage	2.787
	SRR8316894	Third green stage	4.761
	SRR8316900	Third green stage	7.814
	SRR8316901	Third green stage	5.384
	SRR8316898	Complete white stage	2.771
	SRR8316899	Complete white stage	7.809
	SRR8316903	Complete white stage	4.751
	SRR8316902	Silver flowering stage	0.726
	SRR8316904	Silver flowering stage	0.586
	SRR8316905	Silver flowering stage	0.512
	SRR8316906	Gold flowering stage	0.300
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	3.627
	SRR6706287	Light intensity 50%	3.809
	SRR6706288	Light intensity 20%	3.395
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.679
	CNS0095593	Slightly white alabastrum(diploid) 2	9.597
	CNS0095594	Slightly white alabastrum(diploid) 3	3.396
	CNS0095595	Whole white alabastrum(diploid) 2	5.892
	CNS0095596	Whole white alabastrum(diploid) 3	2.120
	CNS0095597	Whole white alabastrum(diploid) 4	3.035
	CNS0095598	Silvery flower (diploied) 1	3.353
	CNS0095599	Silvery flower (diploied) 2	9.070
	CNS0095600	Silvery flower (diploied) 3	3.186
	CNS0095601	Golden flower (diploid) 1	12.225
	CNS0095602	Golden flower (diploid) 2	2.087
	CNS0095603	Golden flower (diploid) 3	2.289
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.791
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.099
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.946
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.335
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.433
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.063
	CNS0095610	Silvery flower (tetraploid) 1	1.309
	CNS0095611	Silvery flower (tetraploid) 2	3.789
	CNS0095612	Silvery flower (tetraploid) 3	1.011
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.780
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	6.004
	CRR073298	Stem 2	4.341
	CRR073299	Stem 3	4.451
	CRR073300	Leaf 1	5.723
	CRR073301	Leaf 2	1.899
	CRR073302	Leaf 3	2.041
	CRR073303	Juvenile bud 1	2.328
	CRR073304	Juvenile bud 2	3.254
	CRR073305	Juvenile bud 3	3.199
	CRR073306	Third green 1	0.111
	CRR073307	Third green 2	0.475
	CRR073308	Third green 3	0.559
	CRR073309	Second white 1	0.177
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	3.670
	CRR073316	Gold flowering 2	2.989
	CRR073317	Gold flowering 3	6.751
	CRR073318	Tawny withering 1	12.477
	CRR073319	Tawny withering 2	2.844
	CRR073320	Tawny withering 3	13.291