Gene detail

Detail information of GWHGAAZE016506

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAO85520.1	1.73412E-81	ent-kaurene oxidase [Prunus persica]
Swissprot	tr\|Q93ZB2\|KO1_ARATH	4E-69	Ent-kaurene oxidase, chloroplastic
trEMBL	tr\|V4K3Q9\|V4K3Q9_EUTSA	5E-88	Uncharacterized protein {ECO:0000313\|EMBL:ESQ32125.1}
TAIR10	AT5G25900.1	4E-59	GA requiring 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	77811397	77814800	-
GWHAAZE00000004	mRNA	77811397	77814800	-
GWHAAZE00000004	exon	77814717	77814800	-
GWHAAZE00000004	exon	77813609	77813793	-
GWHAAZE00000004	exon	77812458	77812650	-
GWHAAZE00000004	exon	77811397	77811708	-
GWHAAZE00000004	CDS	77814717	77814800	-
GWHAAZE00000004	CDS	77813609	77813793	-
GWHAAZE00000004	CDS	77812458	77812650	-
GWHAAZE00000004	CDS	77811397	77811708	-

Transcript Sequence
>GWHTAAZE016526 ATGGTCACTATGAGCGATTACGACGATTTCCATAAGATGGTGAAACGAAATCTCCTCACAAATATTTTGGGACCAAATGCGCAGTCTTTGGGAAAAGATTTTGAATCCATTTACGTCGAGGAACTTGGTGCAACGTTGTCAAGAGAGGAAATGTTTAAGGTTTTAGTGCTCGACCCAACGGAAGGTGCAATTGATGTGGATTGGAGAGATTTTTTTCCATATTTAAAATGGATTCCGAATAAAACTTTTGAAGAGAAACTGCAGCGAATGAACGTCTCTACCAGGAACTTCAAAGTGTGTGAATCTAACAAGATTACAGTGGAAAAATTGTCTCAACTTCCATATTTGAGCGCTGTTTTCCTTGAAACTTTGAGAAAGCATAGTCCTGTTCCGATAATGCCTCTACTATATGTGCATGAAGATACTCAGATAGGAGGATACCACATTCCAGCTGGAAGTGAGATTGCTATAAACGTTTATGCTTGTAGCATGGACAAGAGAGTGTGGGAGGATCCCGAGGAGTGGAAACCCGAGAGATTCCTCGAGAAGGAAAATGACACCATGGATTTGAACAAGACAATGGCGTTTGGGGGCGGGAAGAGAGTTTGCGCAGGCTCCCATGAAACTTTCTTTATCTCTTCTGTGACTATAGGCAGATTAATACAAGAATTTGAATGGAGGCTTGAGGATGGTGAGAAAGATAATGTTCATACTCTGGGTCTTACCACAAAGAAGCTCCACCCAATGCAAGCAATCATAAAGCCGAGAATTTGA

Network for GWHGAAZE016506

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	102	243	4.30E-35

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04122	GA3, CYP701	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Diterpenoid biosynthesis	map00904

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0005506	molecular_function	iron ion binding
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.255
	SRR3591706	second leaf	0.090
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.357
	SRR3591709	Stem	1.273
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.124
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.089
	SRR8316896	Juvenile bud stage	0.249
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.154
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.138
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.030
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.325
	CNS0095593	Slightly white alabastrum(diploid) 2	0.336
	CNS0095594	Slightly white alabastrum(diploid) 3	0.900
	CNS0095595	Whole white alabastrum(diploid) 2	0.069
	CNS0095596	Whole white alabastrum(diploid) 3	0.101
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.049
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.044
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.027
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.390
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.065
	CRR073298	Stem 2	0.050
	CRR073299	Stem 3	0.261
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.169
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.061
	CRR073319	Tawny withering 2	0.501
	CRR073320	Tawny withering 3	0.267