Gene detail

Detail information of GWHGAAZE016470

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007017211.1	8.85573E-76	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein, putative isoform 2 [Theobroma cacao]
trEMBL	tr\|A0A061FBL7\|A0A061FBL7_THECC	3E-76	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein, putative isoform 2 {ECO:0000313\|EMBL:EOY14436.1}
TAIR10	AT1G45231.2	7E-60	S-adenosyl-L-methionine-dependent methyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	77176468	77178503	-
GWHAAZE00000004	mRNA	77176468	77178503	-
GWHAAZE00000004	exon	77176468	77176750	-
GWHAAZE00000004	exon	77176838	77176945	-
GWHAAZE00000004	exon	77178229	77178503	-
GWHAAZE00000004	CDS	77178229	77178503	-
GWHAAZE00000004	CDS	77176838	77176945	-
GWHAAZE00000004	CDS	77176468	77176750	-

Transcript Sequence
>GWHTAAZE016490 ATGTTCTCTTTCCTTTTTAACGAAACAATTTTGCTTCCCACAGAGCTCCAATCCCAAGGGATTTTGGAAGAATTTTCTCCCAGTATTGATAAGTACTGGTGTCAGAGATACCTGCTGTTCTCTAAATTTGATGATGGTATTAAAATGGATGAAGAAGGCTGGTTTTCCGTCACTCCTGAGCCTATAGCAAAGCATCACGCATCCCGTTGTTGTTCTGGCATCATTATTGACTGCTTCACTGGAGTTGGTGGGAATGCCATCCAATTTGCACAAAAAACTATGCTGCAGGCAGATATTGTCTTCCTCTCGCCTCCTTGGGGAGGACCTGATTATGCAAAAGTAAAGAAATTTGACATCAATACCATGCTCAAGCCGCATGACGGTCATTTCCTCTACAATGTTGCAAAGGGAATTGCTTCCAGAATTGTCATGTTCCTCCCAAGAAATGTTGATTTCAATCAACTTGCAGAGTTGTCTGCATCCACCAATCCTCCTTGGTCACTTGAGGTACTTGGGCAAAATTTTATGACATTTGAGGCCGTTTGGCTCAGGGTGAAATGGTTTTCAACTGGGTGAGAAATAAAATACTTCAAAAAAAATTCAGCTCTTCAGTTGCAAAAATCACGATCTAGTTATATGCTGCCTCCGTCCCAAAATGGGGACTGA

Network for GWHGAAZE016470

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF09445.11	Methyltransf_15	95	160	1.20E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14292	TGS1	RNA transport	map03013

Gene Ontology

GO term	Ontology	Name
GO:0001510	biological_process	RNA methylation
GO:0009452	biological_process	7-methylguanosine RNA capping
GO:0008168	molecular_function	methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	5.642
	SRR3591706	second leaf	6.484
	SRR3591707	mature leaf	4.530
	SRR3591708	Shoot apex	10.591
	SRR3591709	Stem	8.063
	SRR3591710	White floral bud	8.028
	SRR3591711	White flower	6.885
	SRR3591712	Green floral bud	6.370
	SRR3591713	Yellow flower	6.551
SRP173429	SRR8316895	Juvenile bud stage	3.034
	SRR8316896	Juvenile bud stage	5.481
	SRR8316897	Juvenile bud stage	1.759
	SRR8316894	Third green stage	1.985
	SRR8316900	Third green stage	4.891
	SRR8316901	Third green stage	5.286
	SRR8316898	Complete white stage	1.261
	SRR8316899	Complete white stage	5.259
	SRR8316903	Complete white stage	1.952
	SRR8316902	Silver flowering stage	1.462
	SRR8316904	Silver flowering stage	3.100
	SRR8316905	Silver flowering stage	1.154
	SRR8316906	Gold flowering stage	3.592
	SRR8316907	Gold flowering stage	3.823
	SRR8316908	Gold flowering stage	4.012
SRP132670	SRR6706286	Control	2.014
	SRR6706287	Light intensity 50%	2.714
	SRR6706288	Light intensity 20%	2.170
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.100
	CNS0095593	Slightly white alabastrum(diploid) 2	4.031
	CNS0095594	Slightly white alabastrum(diploid) 3	4.603
	CNS0095595	Whole white alabastrum(diploid) 2	4.603
	CNS0095596	Whole white alabastrum(diploid) 3	6.486
	CNS0095597	Whole white alabastrum(diploid) 4	5.774
	CNS0095598	Silvery flower (diploied) 1	6.758
	CNS0095599	Silvery flower (diploied) 2	4.647
	CNS0095600	Silvery flower (diploied) 3	4.244
	CNS0095601	Golden flower (diploid) 1	7.540
	CNS0095602	Golden flower (diploid) 2	4.979
	CNS0095603	Golden flower (diploid) 3	4.931
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.532
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.411
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.193
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.166
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.231
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.524
	CNS0095610	Silvery flower (tetraploid) 1	3.745
	CNS0095611	Silvery flower (tetraploid) 2	4.219
	CNS0095612	Silvery flower (tetraploid) 3	3.164
	CNS0095613	Golden flower (tetraploid) 1	3.281
	CNS0095614	Golden flower (tetraploid) 2	6.166
	CNS0095615	Golden flower (tetraploid) 3	5.172
CRA001975	CRR073297	Stem 1	7.811
	CRR073298	Stem 2	8.320
	CRR073299	Stem 3	5.075
	CRR073300	Leaf 1	6.088
	CRR073301	Leaf 2	6.344
	CRR073302	Leaf 3	4.185
	CRR073303	Juvenile bud 1	4.517
	CRR073304	Juvenile bud 2	1.427
	CRR073305	Juvenile bud 3	2.162
	CRR073306	Third green 1	0.590
	CRR073307	Third green 2	0.892
	CRR073308	Third green 3	1.139
	CRR073309	Second white 1	0.415
	CRR073310	Second white 2	2.326
	CRR073311	Second white 3	1.060
	CRR073312	Silver flowering 1	3.327
	CRR073313	Silver flowering 2	1.979
	CRR073314	Silver flowering 3	1.207
	CRR073315	Gold flowering 1	2.421
	CRR073316	Gold flowering 2	4.590
	CRR073317	Gold flowering 3	0.854
	CRR073318	Tawny withering 1	4.677
	CRR073319	Tawny withering 2	5.699
	CRR073320	Tawny withering 3	5.833