Gene detail

Detail information of GWHGAAZE016468

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002282817.1	3.47915E-58	PREDICTED: transcription factor HEC1 [Vitis vinifera]
Swissprot	tr\|Q9SND4\|HEC2_ARATH	2E-42	Transcription factor HEC2
trEMBL	tr\|E0CPU4\|E0CPU4_VITVI	1E-58	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI19507.3}
TAIR10	AT5G67060.1	2E-30	basic helix-loop-helix (bHLH) DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	77147867	77148277	+
GWHAAZE00000004	mRNA	77147867	77148277	+
GWHAAZE00000004	exon	77147867	77148277	+
GWHAAZE00000004	CDS	77147867	77148277	+

Transcript Sequence
>GWHTAAZE016488 ATGGCGGAGATGAGGGAAATGATTTTCCGGGTATCCTCAATGCAGCCGATTCACATCGACCCGGAATCGGTTAAGCCGAAAAAACGGCGGAACGTGAAGATTTCGAGAGACCCACAGAGTGTGGCGGCTCGCCACCGCCGGGAAAGGATAAGTGAAAGGATTCGGATTCTGCAGAGGATTGTACCCGGTGGAACGAAATTGGATACGGCTTCTATGTTAGATGTGGCCATTCATTATGTGAAGTTTTTGAAAGGTCAAGTGCAGTTGCTAGAAGGGGCAGCCGTGTTGGGTAACCGGCCGGCGGTTGTGGGGTCTCCGGTGGAAATGTCTAGTGGGAATTGGTTTTCCATGGGGAGGGAAAGTAGTTATCAAGTAGTGGGTCAAAGTGTTCAGCAATATTTAGATGTTTAG

Network for GWHGAAZE016468

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00010.27	HLH	42	83	4.90E-07

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bHLH

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0046983	molecular_function	protein dimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.959
	SRR3591706	second leaf	3.920
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	7.891
	SRR3591709	Stem	2.482
	SRR3591710	White floral bud	0.192
	SRR3591711	White flower	3.113
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	1.477
SRP173429	SRR8316895	Juvenile bud stage	0.544
	SRR8316896	Juvenile bud stage	0.615
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.205
	SRR8316901	Third green stage	0.175
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.142
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.106
	SRR8316906	Gold flowering stage	0.126
	SRR8316907	Gold flowering stage	0.010
	SRR8316908	Gold flowering stage	0.030
SRP132670	SRR6706286	Control	0.174
	SRR6706287	Light intensity 50%	0.345
	SRR6706288	Light intensity 20%	0.031
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.022
	CNS0095593	Slightly white alabastrum(diploid) 2	0.297
	CNS0095594	Slightly white alabastrum(diploid) 3	1.219
	CNS0095595	Whole white alabastrum(diploid) 2	0.150
	CNS0095596	Whole white alabastrum(diploid) 3	0.057
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	1.183
	CNS0095600	Silvery flower (diploied) 3	0.090
	CNS0095601	Golden flower (diploid) 1	1.971
	CNS0095602	Golden flower (diploid) 2	1.554
	CNS0095603	Golden flower (diploid) 3	1.348
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.212
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.361
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.645
	CNS0095611	Silvery flower (tetraploid) 2	0.282
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.017
	CNS0095614	Golden flower (tetraploid) 2	0.206
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.670
	CRR073298	Stem 2	1.295
	CRR073299	Stem 3	2.963
	CRR073300	Leaf 1	0.164
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.274
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.149
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.452
	CRR073316	Gold flowering 2	0.295
	CRR073317	Gold flowering 3	1.043
	CRR073318	Tawny withering 1	0.126
	CRR073319	Tawny withering 2	0.438
	CRR073320	Tawny withering 3	0.122