Gene detail

Detail information of GWHGAAZE016236

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHJ08575.1	5.03037E-77	DREB6-like protein [Cichorium intybus]
Swissprot	tr\|Q8H1E4\|RAP24_ARATH	1E-68	Ethylene-responsive transcription factor RAP2-4
trEMBL	tr\|A0A023JIR1\|A0A023JIR1_CICIN	2E-77	DREB6-like protein {ECO:0000313\|EMBL:AHJ08575.1}
TAIR10	AT1G78080.1	8E-45	related to AP2 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	72042143	72042730	-
GWHAAZE00000004	mRNA	72042143	72042730	-
GWHAAZE00000004	exon	72042338	72042730	-
GWHAAZE00000004	exon	72042143	72042298	-
GWHAAZE00000004	CDS	72042338	72042730	-
GWHAAZE00000004	CDS	72042143	72042298	-

Transcript Sequence
>GWHTAAZE016256 ATGAAGCAAGTCTGGTCTCTCCAAAAACCCGCCAAGCTCTACAGGGGAGTCAGACAGAGGCACTGGGGAAAATGGGTCGCCGAGATCCGTTTACCCAAGAACCGGACCAGGCTTTGGCTCGGTACTTTTGATACGGCTGAAGAAGCTGCGCTGGCATACGACAAGGCGGCTTACAGCCTACGTGGGGATTCGGCTCGGCTCAACTTCCCCCAGCTCAGTCACAAAGGGTCCCACATCGGAGACTACAAGCCGCTTCACTCCGCCGTCGACGCCAAGCTCCAAGCCATCTGCAAGAACTTAGCCGACGGGAAGCCCATCGACGGAAAGAAACCGAGGAAGAAGTCACCTGACGCATCGGACACGTGTACGTCAGTACCTGACACGAGTCCGGAGTCGGGATGCTCGGAGAGTGGTGGTTCCAGTTCGGCGTTGTCGGATCTGACTTTTGCGGAGTTTACGGAGGAGGATCCCATGTGGGATGGTTGCTCGTCGGAGAATTTGATGTTGGAAAAGTATCCATCTAATGAAATAGATTGGAGTTCGATTTGA

Network for GWHGAAZE016236

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	14	62	5.50E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	46.629
	SRR3591706	second leaf	20.647
	SRR3591707	mature leaf	45.951
	SRR3591708	Shoot apex	68.615
	SRR3591709	Stem	103.031
	SRR3591710	White floral bud	42.478
	SRR3591711	White flower	57.080
	SRR3591712	Green floral bud	19.719
	SRR3591713	Yellow flower	23.418
SRP173429	SRR8316895	Juvenile bud stage	39.931
	SRR8316896	Juvenile bud stage	41.292
	SRR8316897	Juvenile bud stage	23.937
	SRR8316894	Third green stage	10.734
	SRR8316900	Third green stage	11.453
	SRR8316901	Third green stage	19.276
	SRR8316898	Complete white stage	2.974
	SRR8316899	Complete white stage	29.771
	SRR8316903	Complete white stage	4.209
	SRR8316902	Silver flowering stage	5.086
	SRR8316904	Silver flowering stage	3.434
	SRR8316905	Silver flowering stage	2.571
	SRR8316906	Gold flowering stage	10.697
	SRR8316907	Gold flowering stage	12.025
	SRR8316908	Gold flowering stage	10.672
SRP132670	SRR6706286	Control	4.877
	SRR6706287	Light intensity 50%	4.225
	SRR6706288	Light intensity 20%	3.777
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.675
	CNS0095593	Slightly white alabastrum(diploid) 2	27.563
	CNS0095594	Slightly white alabastrum(diploid) 3	31.050
	CNS0095595	Whole white alabastrum(diploid) 2	27.598
	CNS0095596	Whole white alabastrum(diploid) 3	5.096
	CNS0095597	Whole white alabastrum(diploid) 4	18.177
	CNS0095598	Silvery flower (diploied) 1	92.347
	CNS0095599	Silvery flower (diploied) 2	111.447
	CNS0095600	Silvery flower (diploied) 3	38.886
	CNS0095601	Golden flower (diploid) 1	153.378
	CNS0095602	Golden flower (diploid) 2	102.519
	CNS0095603	Golden flower (diploid) 3	90.511
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.853
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.174
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.558
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.273
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.714
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.271
	CNS0095610	Silvery flower (tetraploid) 1	10.809
	CNS0095611	Silvery flower (tetraploid) 2	10.514
	CNS0095612	Silvery flower (tetraploid) 3	20.309
	CNS0095613	Golden flower (tetraploid) 1	6.477
	CNS0095614	Golden flower (tetraploid) 2	11.780
	CNS0095615	Golden flower (tetraploid) 3	6.454
CRA001975	CRR073297	Stem 1	60.092
	CRR073298	Stem 2	63.006
	CRR073299	Stem 3	63.710
	CRR073300	Leaf 1	80.089
	CRR073301	Leaf 2	107.940
	CRR073302	Leaf 3	39.079
	CRR073303	Juvenile bud 1	46.952
	CRR073304	Juvenile bud 2	17.374
	CRR073305	Juvenile bud 3	55.613
	CRR073306	Third green 1	18.470
	CRR073307	Third green 2	17.129
	CRR073308	Third green 3	17.631
	CRR073309	Second white 1	14.353
	CRR073310	Second white 2	16.572
	CRR073311	Second white 3	9.186
	CRR073312	Silver flowering 1	30.497
	CRR073313	Silver flowering 2	50.080
	CRR073314	Silver flowering 3	34.844
	CRR073315	Gold flowering 1	24.233
	CRR073316	Gold flowering 2	40.377
	CRR073317	Gold flowering 3	18.591
	CRR073318	Tawny withering 1	100.244
	CRR073319	Tawny withering 2	152.531
	CRR073320	Tawny withering 3	111.030