Gene detail

Detail information of GWHGAAZE016210

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHJ08575.1	5.03037E-77	DREB6-like protein [Cichorium intybus]
Swissprot	tr\|Q8H1E4\|RAP24_ARATH	1E-68	Ethylene-responsive transcription factor RAP2-4
trEMBL	tr\|A0A023JIR1\|A0A023JIR1_CICIN	2E-77	DREB6-like protein {ECO:0000313\|EMBL:AHJ08575.1}
TAIR10	AT1G78080.1	8E-45	related to AP2 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	71666190	71666777	-
GWHAAZE00000004	mRNA	71666190	71666777	-
GWHAAZE00000004	exon	71666385	71666777	-
GWHAAZE00000004	exon	71666190	71666345	-
GWHAAZE00000004	CDS	71666385	71666777	-
GWHAAZE00000004	CDS	71666190	71666345	-

Transcript Sequence
>GWHTAAZE016230 ATGAAGCAAGTCTGGTCTCTCCAAAAACCCGCCAAGCTCTACAGGGGAGTCAGACAGAGGCACTGGGGAAAATGGGTCGCCGAGATCCGTTTACCCAAGAACCGGACCAGGCTTTGGCTCGGTACTTTTGATACGGCTGAAGAAGCTGCGCTGGCATACGACAAGGCGGCTTACAGCCTACGTGGGGATTCGGCTCGGCTCAACTTCCCCCAGCTCAGTCACAAAGGGTCCCACATCGGAGACTACAAGCCGCTTCACTCCGCCGTCGACGCCAAGCTCCAAGCCATCTGCAAGAACTTAGCCGACGGGAAGCCCATCGACGGAAAGAAACCGAGGAAGAAGTCACCTGACGCATCGGACACGTGTACGTCAGTACCTGACACGAGTCCGGAGTCGGGATGCTCGGAGAGTGGTGGTTCCAGTTCGGCGTTGTCGGATCTGACTTTTGCGGAGTTTACGGAGGAGGATCCCATGTGGGATGGTTGCTCGTCGGAGAATTTGATGTTGGAAAAGTATCCATCTAATGAAATAGATTGGAGTTCGATTTGA

Network for GWHGAAZE016210

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	14	62	5.50E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	45.602
	SRR3591706	second leaf	20.401
	SRR3591707	mature leaf	44.435
	SRR3591708	Shoot apex	69.310
	SRR3591709	Stem	101.732
	SRR3591710	White floral bud	41.154
	SRR3591711	White flower	57.067
	SRR3591712	Green floral bud	19.458
	SRR3591713	Yellow flower	21.915
SRP173429	SRR8316895	Juvenile bud stage	37.317
	SRR8316896	Juvenile bud stage	38.654
	SRR8316897	Juvenile bud stage	23.494
	SRR8316894	Third green stage	10.602
	SRR8316900	Third green stage	10.253
	SRR8316901	Third green stage	18.356
	SRR8316898	Complete white stage	2.787
	SRR8316899	Complete white stage	30.136
	SRR8316903	Complete white stage	4.519
	SRR8316902	Silver flowering stage	4.831
	SRR8316904	Silver flowering stage	3.076
	SRR8316905	Silver flowering stage	2.343
	SRR8316906	Gold flowering stage	10.393
	SRR8316907	Gold flowering stage	10.361
	SRR8316908	Gold flowering stage	10.903
SRP132670	SRR6706286	Control	5.059
	SRR6706287	Light intensity 50%	4.527
	SRR6706288	Light intensity 20%	3.973
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	29.399
	CNS0095593	Slightly white alabastrum(diploid) 2	27.143
	CNS0095594	Slightly white alabastrum(diploid) 3	29.160
	CNS0095595	Whole white alabastrum(diploid) 2	26.812
	CNS0095596	Whole white alabastrum(diploid) 3	5.413
	CNS0095597	Whole white alabastrum(diploid) 4	17.287
	CNS0095598	Silvery flower (diploied) 1	89.008
	CNS0095599	Silvery flower (diploied) 2	106.806
	CNS0095600	Silvery flower (diploied) 3	38.300
	CNS0095601	Golden flower (diploid) 1	151.375
	CNS0095602	Golden flower (diploid) 2	99.320
	CNS0095603	Golden flower (diploid) 3	88.955
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.949
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.130
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.035
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.375
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.741
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.334
	CNS0095610	Silvery flower (tetraploid) 1	11.250
	CNS0095611	Silvery flower (tetraploid) 2	10.176
	CNS0095612	Silvery flower (tetraploid) 3	20.443
	CNS0095613	Golden flower (tetraploid) 1	6.306
	CNS0095614	Golden flower (tetraploid) 2	11.407
	CNS0095615	Golden flower (tetraploid) 3	6.643
CRA001975	CRR073297	Stem 1	60.196
	CRR073298	Stem 2	62.228
	CRR073299	Stem 3	61.329
	CRR073300	Leaf 1	79.102
	CRR073301	Leaf 2	107.747
	CRR073302	Leaf 3	39.138
	CRR073303	Juvenile bud 1	47.433
	CRR073304	Juvenile bud 2	15.891
	CRR073305	Juvenile bud 3	57.262
	CRR073306	Third green 1	18.233
	CRR073307	Third green 2	16.741
	CRR073308	Third green 3	16.709
	CRR073309	Second white 1	14.630
	CRR073310	Second white 2	15.969
	CRR073311	Second white 3	8.836
	CRR073312	Silver flowering 1	30.388
	CRR073313	Silver flowering 2	48.415
	CRR073314	Silver flowering 3	34.147
	CRR073315	Gold flowering 1	23.987
	CRR073316	Gold flowering 2	39.758
	CRR073317	Gold flowering 3	18.524
	CRR073318	Tawny withering 1	97.688
	CRR073319	Tawny withering 2	152.409
	CRR073320	Tawny withering 3	110.786