Gene detail

Detail information of GWHGAAZE016182

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002274963.1	5.9819E-107	PREDICTED: ATP synthase delta chain, chloroplastic [Vitis vinifera]
Swissprot	tr\|P32980\|ATPD_TOBAC	1E-106	ATP synthase delta chain, chloroplastic (Precursor)
trEMBL	tr\|F6HVW3\|F6HVW3_VITVI	2E-107	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB58826.1}
TAIR10	AT4G09650.1	2E-62	ATP synthase delta-subunit gene

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	71048148	71057318	+
GWHAAZE00000004	mRNA	71048148	71057318	+
GWHAAZE00000004	exon	71048148	71048525	+
GWHAAZE00000004	exon	71056956	71057318	+
GWHAAZE00000004	CDS	71048148	71048525	+
GWHAAZE00000004	CDS	71056956	71057318	+

Transcript Sequence
>GWHTAAZE016202 ATGGCCACTCTACAACAAGCTCCGATAACATTCCAATCCCACTCGCCGCCTTCGACAAAAATCATAGCCGGAAAACCTCTCCGACTCTCTTTCTCAAGCAGTTTGTCCTCCGTGAAACTCCCAAAGCTCACCACCAAACTACTCGGAAAATCCGGCGGCCGCTTCAGGATGGCGGAGAGCGCCGCAGGAAACTACGCGAAAGCCGTCGCCGACATCGCGATGTCGAACGGAACCCTAGAAACAACCGCCGATGATATCGATAAGGTCGCCAAGGTATTCGCGGAGCCTGGAGTCTTGGATTTCTTCGCGAGCCCTATCATTGATGTGGAGAAGAAGCGAGAGATGATCGACGAGATCTCTAAATCGGCGAATCTACAGCCTCACGTGGAGAACTTCCTCAACGTACTGATCGACTCACGGAGGATTGAGATTATTGAAGAGATTTTTAAGGAATTCGAGCTCGTTTACAACAAATTGACCGATACAGAGATGGCGATTGTGAGTTCGGTGGTGAAATTGGAATCGCAACACTTGGCAAAGATTGCAAAGAGAGTGCAGAAACTGACCGGAGCTAAGAACGTGAGGATTAAGACGGTGATTGATCCGTCTTTATTGGCCGGATTCATGATCAGGTATGGAAGTTCTGGATCGAAGCTTATTGATATGAGTGTGAAGAAACAGATTGAAGAGATTTCTGCTGAGTTCAAACTTGATGACATTCAACTTGCTGCAGGAGTATGA

Network for GWHGAAZE016182

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00213.19	OSCP	62	233	2.80E-41

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02113	ATPF1D, atpH	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0016020	cellular_component	membrane
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.304
	SRR3591706	second leaf	1.323
	SRR3591707	mature leaf	3.922
	SRR3591708	Shoot apex	5.001
	SRR3591709	Stem	10.139
	SRR3591710	White floral bud	11.694
	SRR3591711	White flower	17.838
	SRR3591712	Green floral bud	3.352
	SRR3591713	Yellow flower	18.332
SRP173429	SRR8316895	Juvenile bud stage	4.683
	SRR8316896	Juvenile bud stage	7.631
	SRR8316897	Juvenile bud stage	2.776
	SRR8316894	Third green stage	3.118
	SRR8316900	Third green stage	3.885
	SRR8316901	Third green stage	5.888
	SRR8316898	Complete white stage	7.175
	SRR8316899	Complete white stage	10.192
	SRR8316903	Complete white stage	9.807
	SRR8316902	Silver flowering stage	8.374
	SRR8316904	Silver flowering stage	8.259
	SRR8316905	Silver flowering stage	6.744
	SRR8316906	Gold flowering stage	16.542
	SRR8316907	Gold flowering stage	18.057
	SRR8316908	Gold flowering stage	21.915
SRP132670	SRR6706286	Control	7.434
	SRR6706287	Light intensity 50%	5.313
	SRR6706288	Light intensity 20%	6.828
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.795
	CNS0095593	Slightly white alabastrum(diploid) 2	7.703
	CNS0095594	Slightly white alabastrum(diploid) 3	15.336
	CNS0095595	Whole white alabastrum(diploid) 2	5.752
	CNS0095596	Whole white alabastrum(diploid) 3	4.602
	CNS0095597	Whole white alabastrum(diploid) 4	7.293
	CNS0095598	Silvery flower (diploied) 1	16.861
	CNS0095599	Silvery flower (diploied) 2	9.524
	CNS0095600	Silvery flower (diploied) 3	16.345
	CNS0095601	Golden flower (diploid) 1	10.592
	CNS0095602	Golden flower (diploid) 2	15.000
	CNS0095603	Golden flower (diploid) 3	18.092
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.580
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.264
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.706
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.207
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.411
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.591
	CNS0095610	Silvery flower (tetraploid) 1	18.853
	CNS0095611	Silvery flower (tetraploid) 2	11.330
	CNS0095612	Silvery flower (tetraploid) 3	14.435
	CNS0095613	Golden flower (tetraploid) 1	12.408
	CNS0095614	Golden flower (tetraploid) 2	13.133
	CNS0095615	Golden flower (tetraploid) 3	17.180
CRA001975	CRR073297	Stem 1	10.266
	CRR073298	Stem 2	10.007
	CRR073299	Stem 3	15.165
	CRR073300	Leaf 1	9.271
	CRR073301	Leaf 2	8.708
	CRR073302	Leaf 3	6.997
	CRR073303	Juvenile bud 1	8.694
	CRR073304	Juvenile bud 2	12.109
	CRR073305	Juvenile bud 3	8.501
	CRR073306	Third green 1	15.346
	CRR073307	Third green 2	16.705
	CRR073308	Third green 3	13.502
	CRR073309	Second white 1	12.997
	CRR073310	Second white 2	12.936
	CRR073311	Second white 3	11.947
	CRR073312	Silver flowering 1	14.497
	CRR073313	Silver flowering 2	17.702
	CRR073314	Silver flowering 3	12.081
	CRR073315	Gold flowering 1	6.971
	CRR073316	Gold flowering 2	6.355
	CRR073317	Gold flowering 3	5.437
	CRR073318	Tawny withering 1	15.738
	CRR073319	Tawny withering 2	21.754
	CRR073320	Tawny withering 3	14.647