Gene detail

Detail information of GWHGAAZE016042

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP07073.1	9.8454E-128	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068UHF6\|A0A068UHF6_COFCA	4E-128	Coffea canephora DH200=94 genomic scaffold, scaffold_24 {ECO:0000313\|EMBL:CDP07073.1}
TAIR10	AT3G45100.2	6E-95	UDP-Glycosyltransferase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	67496309	67497531	+
GWHAAZE00000004	mRNA	67496309	67497531	+
GWHAAZE00000004	exon	67496309	67496833	+
GWHAAZE00000004	exon	67497418	67497531	+
GWHAAZE00000004	CDS	67496309	67496833	+
GWHAAZE00000004	CDS	67497418	67497531	+

Transcript Sequence
>GWHTAAZE016062 ATGACTGGCGGCCTTAAAGTCTACTATATACCTTGGAAACCGTTTCTTATGCAAAACACATTGCCCACATTTTATGGTACACTTTCCATTATAAGGACAATTCTCATCCGAGAAAAAATATCATTAATAAGTGGACATCAAGCATTCTCAACTCTTTGTCATGAGGCTCATATGCATGCACGCACTATGGGATATAAAGTTGTATTTACTGATCATTCACTCTATGGTTTTGCTGATGCGGGTAGCATTCACATGAACAAGGTGTTACAATTTACTTTAGCAGATGTTACCGAGGCCATTTGGGTTTCTCATACGAGTAAGGAAAGTACAGTTCTAAGGTCGGGCTTGCCGCCCGAAAAGGTGTTTGTTATTCCAAACGCTGTGGACATGGCTATGTTCAAGCCTGCTCAACAGAGACTCGGAAGTGATGAAATTATCATAGTGGTGATAAGTAGATTGGTCTATCGGAAAGGTGCAGATTTGCTAGTTGAGATTATCCCCGAAGTATGCCGGTTGTATCCCAATGTTCGTTTCATTGTCAAATTCCACATAACCCTTCAGGACCGAGTTGATATGTTAGGTGCTGTACCTCATGCTAAAGTACGTCCAGTCTTGATTTCTGGCCACATATTCTTAATT

Network for GWHGAAZE016042

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08288.13	PIGA	1	79	6.90E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03857	PIGA, GPI3	Metabolic pathways	map01100
K03857	PIGA, GPI3	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.204
	SRR3591708	Shoot apex	0.113
	SRR3591709	Stem	0.064
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.115
	SRR3591712	Green floral bud	0.042
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.240
	SRR8316896	Juvenile bud stage	0.052
	SRR8316897	Juvenile bud stage	0.086
	SRR8316894	Third green stage	0.027
	SRR8316900	Third green stage	0.077
	SRR8316901	Third green stage	0.217
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.071
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.057
	SRR8316904	Silver flowering stage	0.105
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.127
	SRR8316907	Gold flowering stage	0.215
	SRR8316908	Gold flowering stage	0.038
SRP132670	SRR6706286	Control	0.040
	SRR6706287	Light intensity 50%	0.199
	SRR6706288	Light intensity 20%	0.021
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.184
	CNS0095593	Slightly white alabastrum(diploid) 2	0.044
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.165
	CNS0095597	Whole white alabastrum(diploid) 4	0.211
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.448
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.233
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.074
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.088
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.338
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.376
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.169
	CNS0095612	Silvery flower (tetraploid) 3	0.167
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.118
	CNS0095615	Golden flower (tetraploid) 3	0.266
CRA001975	CRR073297	Stem 1	0.220
	CRR073298	Stem 2	0.098
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.152
	CRR073301	Leaf 2	0.051
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.116
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.017
	CRR073306	Third green 1	0.027
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.081
	CRR073311	Second white 3	0.122
	CRR073312	Silver flowering 1	0.011
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.222
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000