Gene detail

Detail information of GWHGAAZE015754

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007021885.1	1.35832E-38	Leucine-rich repeat protein kinase family protein, putative [Theobroma cacao]
Swissprot	tr\|Q9SD62\|Y3471_ARATH	1E-16	Putative receptor-like protein kinase At3g47110 (Precursor)
trEMBL	tr\|A0A061F7S3\|A0A061F7S3_THECC	5E-39	Leucine-rich repeat protein kinase family protein, putative {ECO:0000313\|EMBL:EOY13410.1}
TAIR10	AT3G47580.1	7E-16	Leucine-rich repeat protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	55695861	55696238	-
GWHAAZE00000004	mRNA	55695861	55696238	-
GWHAAZE00000004	exon	55695861	55696238	-
GWHAAZE00000004	CDS	55695861	55696238	-

Transcript Sequence
>GWHTAAZE015770 ATGCTTTTATCATGCATAGAATATGGAAGAGAAGGAATAGTTTCCACGAAAGGAGATGTTTATAGCTATGGTATTCTGTTAATGGAAACATTCACAAGGAAGAAGCCAACAGATGAAATGTTTTCTGATATATTGACTATGAGGAGTTGGGTTTATGAAGCATCACTCGGTCTAATAGTTCAAGTTGTAGACGCCCACTTGATTCGAAGAGGAGATGAAGACTTCTTGGCCGTGAAGGAATGTGCCTCATCCATCTTACATTTGGCCTTGGATTGTTCGACAAATATTCCTACACAGAGGATCAGCATGGAAGATGTTGTCGTTAGACTCAACAAGATCAAAATTATTTTTCTAAGGAACACTCGAAAAGTCTCATGA

Network for GWHGAAZE015754

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	7	109	3.30E-06

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-XII-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.085
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.061
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.006
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.040
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.002
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.007
	CNS0095602	Golden flower (diploid) 2	0.005
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.007
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.027
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.029
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.152
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.018
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.015
	CRR073312	Silver flowering 1	0.007
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.012
	CRR073320	Tawny withering 3	0.000