Gene detail

Detail information of GWHGAAZE015554

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011079992.1	1.56148E-62	PREDICTED: DNA-directed RNA polymerase III subunit RPC8 isoform X1 [Sesamum indicum]
trEMBL	tr\|D7TPA5\|D7TPA5_VITVI	6E-58	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI32328.3}
TAIR10	AT1G06790.2	3E-39	RNA polymerase Rpb7 N-terminal domain-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	46943192	46945589	-
GWHAAZE00000004	mRNA	46943192	46945589	-
GWHAAZE00000004	exon	46943192	46943280	-
GWHAAZE00000004	exon	46943612	46943699	-
GWHAAZE00000004	exon	46945226	46945321	-
GWHAAZE00000004	exon	46945455	46945589	-
GWHAAZE00000004	CDS	46945455	46945589	-
GWHAAZE00000004	CDS	46945226	46945321	-
GWHAAZE00000004	CDS	46943612	46943699	-
GWHAAZE00000004	CDS	46943192	46943280	-

Transcript Sequence
>GWHTAAZE015570 ATGTTCTACTTGAGTGAAATTGAGCACACATTGAGATTGCCACCTCATCTTCTTAATCTTCCTCTCAATGAAGCAATTAAGGGGGAGCTCGAGGGTCTCTTCTTAGATAAGGTCTTCTGCCTGTGCCTTCCCTTCGTTATTGCAAATTTGGGTTTATGTATATCCGTCTATGATATCCAATCCATTGAGGGAGGTTTTATCTTTGCTGGCGATGGTGCTTCAACCTACACGGTAAAGTTCAGGCTGATAATGTTTTGTCCATTCGTGGGAGAGGTTATAGGTGCAAAGCTTAAAGGGTCTAATGCTAATGGTTTACACTTATCACTTGGATTTTTTGATGACATTTACGTCCCAGCCCATCTAATGCCAAACCCTTCTCACTCTGAGCCTGACCCAGAAAATAAGTGA

Network for GWHGAAZE015554

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03876.18	SHS2_Rpb7-N	8	72	1.80E-10
PF08292.13	RNA_pol_Rbc25	91	127	1.50E-07

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03022	RPC8, POLR3H	RNA polymerase	map03020
K03022	RPC8, POLR3H	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	23.191
	SRR3591706	second leaf	14.558
	SRR3591707	mature leaf	13.077
	SRR3591708	Shoot apex	18.382
	SRR3591709	Stem	17.522
	SRR3591710	White floral bud	13.640
	SRR3591711	White flower	16.760
	SRR3591712	Green floral bud	17.317
	SRR3591713	Yellow flower	21.336
SRP173429	SRR8316895	Juvenile bud stage	19.394
	SRR8316896	Juvenile bud stage	24.279
	SRR8316897	Juvenile bud stage	11.123
	SRR8316894	Third green stage	9.322
	SRR8316900	Third green stage	30.694
	SRR8316901	Third green stage	28.950
	SRR8316898	Complete white stage	13.229
	SRR8316899	Complete white stage	45.605
	SRR8316903	Complete white stage	19.302
	SRR8316902	Silver flowering stage	15.480
	SRR8316904	Silver flowering stage	20.989
	SRR8316905	Silver flowering stage	11.480
	SRR8316906	Gold flowering stage	44.882
	SRR8316907	Gold flowering stage	29.826
	SRR8316908	Gold flowering stage	31.189
SRP132670	SRR6706286	Control	4.191
	SRR6706287	Light intensity 50%	4.949
	SRR6706288	Light intensity 20%	5.497
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.570
	CNS0095593	Slightly white alabastrum(diploid) 2	16.439
	CNS0095594	Slightly white alabastrum(diploid) 3	17.437
	CNS0095595	Whole white alabastrum(diploid) 2	23.707
	CNS0095596	Whole white alabastrum(diploid) 3	15.226
	CNS0095597	Whole white alabastrum(diploid) 4	15.184
	CNS0095598	Silvery flower (diploied) 1	22.203
	CNS0095599	Silvery flower (diploied) 2	19.584
	CNS0095600	Silvery flower (diploied) 3	24.733
	CNS0095601	Golden flower (diploid) 1	19.922
	CNS0095602	Golden flower (diploid) 2	21.538
	CNS0095603	Golden flower (diploid) 3	22.685
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.007
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.205
	CNS0095606	Slightly white alabastrum(tetraploid) 3	35.367
	CNS0095607	Whole white alabastrum(tetraploid) 1	17.319
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.971
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.067
	CNS0095610	Silvery flower (tetraploid) 1	26.939
	CNS0095611	Silvery flower (tetraploid) 2	24.099
	CNS0095612	Silvery flower (tetraploid) 3	27.521
	CNS0095613	Golden flower (tetraploid) 1	18.654
	CNS0095614	Golden flower (tetraploid) 2	25.091
	CNS0095615	Golden flower (tetraploid) 3	20.194
CRA001975	CRR073297	Stem 1	9.862
	CRR073298	Stem 2	11.002
	CRR073299	Stem 3	5.839
	CRR073300	Leaf 1	10.699
	CRR073301	Leaf 2	6.079
	CRR073302	Leaf 3	6.332
	CRR073303	Juvenile bud 1	7.556
	CRR073304	Juvenile bud 2	4.931
	CRR073305	Juvenile bud 3	7.621
	CRR073306	Third green 1	2.506
	CRR073307	Third green 2	4.389
	CRR073308	Third green 3	3.345
	CRR073309	Second white 1	9.905
	CRR073310	Second white 2	9.729
	CRR073311	Second white 3	6.815
	CRR073312	Silver flowering 1	4.949
	CRR073313	Silver flowering 2	5.021
	CRR073314	Silver flowering 3	3.444
	CRR073315	Gold flowering 1	3.726
	CRR073316	Gold flowering 2	9.224
	CRR073317	Gold flowering 3	6.788
	CRR073318	Tawny withering 1	4.343
	CRR073319	Tawny withering 2	3.598
	CRR073320	Tawny withering 3	10.173