Gene detail

Detail information of GWHGAAZE015532

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002526414.1	7.4286E-112	12-oxophytodienoate reductase opr, putative [Ricinus communis]
Swissprot	tr\|Q9XG54\|OPR1_SOLLC	5E-103	12-oxophytodienoate reductase 1
trEMBL	tr\|B9SK95\|B9SK95_RICCO	3E-112	12-oxophytodienoate reductase opr, putative {ECO:0000313\|EMBL:EEF35990.1}
TAIR10	AT1G76690.1	2E-83	12-oxophytodienoate reductase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	45979931	45983270	+
GWHAAZE00000004	mRNA	45979931	45983270	+
GWHAAZE00000004	exon	45979931	45980070	+
GWHAAZE00000004	exon	45980445	45980575	+
GWHAAZE00000004	exon	45982067	45982240	+
GWHAAZE00000004	exon	45983170	45983270	+
GWHAAZE00000004	CDS	45979931	45980070	+
GWHAAZE00000004	CDS	45980445	45980575	+
GWHAAZE00000004	CDS	45982067	45982240	+
GWHAAZE00000004	CDS	45983170	45983270	+

Transcript Sequence
>GWHTAAZE015548 ATTGTTTTGGCACCGCTAACGAGGCAGAGATCATACAACAATGTCCCTCAGCCACATGCTATCTTGTATTACTCCCAAAGAACCACTAAAGGGGGACTTCTCATAGCAGAAGCCACCGGAATTTCAGATACTTCCCGAGGGTATCCAGATGTACCTGGGATATGGACAATGGAACAAGTTGAAGCATGGAAACCCATTGTAGATGCTGTTCATGCCAAAGGTGGCATCTTCTTTTGCCAAATTTGGCATACAGGGAGGGTTTCAAATCGGGGATTTCAGCCAAATGGACAGGATCCAATTTCGTCTACAGACAAGCCATTAACTCAAATACAAAGCAATGGCATAGATGTTGCAGAGTTTACACCTCCACGACGGCTAGCTACAGATGAAATTCCTGAAATTGTCCAGCATTTTAGACTTGCCGCAAGAAATGCAATGGAAGCTGGTTTTGACGGGGTTGAGATCCATGGAGCTCATGGTTACCTAATAGACCAGTTTATGAAGGACCAAGTCAACGATCGAACAGGCAGTATGGAGGCTCGCTAG

Network for GWHGAAZE015532

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0089	GO:0010181 FMN binding GOslim:molecular_function map00592 alpha-Linolenic acid metabolism GO:0003824 catalytic activity GOslim:molecular_function GO:0016491 oxidoreductase activity GOslim:molecular_function GO:0055114 oxidation-reduction process GOslim:biological_process map01110 Biosynthesis of secondary metabolites map01100 Metabolic pathways

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00724.21	Oxidored_FMN	1	175	1.90E-44

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05894	OPR	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		alpha-Linolenic acid metabolism	map00592

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0010181	molecular_function	FMN binding
GO:0016491	molecular_function	oxidoreductase activity
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.602
	SRR3591706	second leaf	5.242
	SRR3591707	mature leaf	0.869
	SRR3591708	Shoot apex	3.123
	SRR3591709	Stem	15.913
	SRR3591710	White floral bud	14.659
	SRR3591711	White flower	23.752
	SRR3591712	Green floral bud	20.908
	SRR3591713	Yellow flower	35.614
SRP173429	SRR8316895	Juvenile bud stage	5.553
	SRR8316896	Juvenile bud stage	9.273
	SRR8316897	Juvenile bud stage	3.133
	SRR8316894	Third green stage	2.649
	SRR8316900	Third green stage	12.944
	SRR8316901	Third green stage	14.786
	SRR8316898	Complete white stage	3.925
	SRR8316899	Complete white stage	19.072
	SRR8316903	Complete white stage	6.009
	SRR8316902	Silver flowering stage	11.503
	SRR8316904	Silver flowering stage	21.472
	SRR8316905	Silver flowering stage	15.366
	SRR8316906	Gold flowering stage	44.444
	SRR8316907	Gold flowering stage	22.409
	SRR8316908	Gold flowering stage	49.326
SRP132670	SRR6706286	Control	17.789
	SRR6706287	Light intensity 50%	18.303
	SRR6706288	Light intensity 20%	19.826
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.890
	CNS0095593	Slightly white alabastrum(diploid) 2	34.953
	CNS0095594	Slightly white alabastrum(diploid) 3	30.098
	CNS0095595	Whole white alabastrum(diploid) 2	31.569
	CNS0095596	Whole white alabastrum(diploid) 3	25.997
	CNS0095597	Whole white alabastrum(diploid) 4	37.817
	CNS0095598	Silvery flower (diploied) 1	5.574
	CNS0095599	Silvery flower (diploied) 2	3.526
	CNS0095600	Silvery flower (diploied) 3	20.773
	CNS0095601	Golden flower (diploid) 1	3.153
	CNS0095602	Golden flower (diploid) 2	11.521
	CNS0095603	Golden flower (diploid) 3	10.247
	CNS0095604	Slightly white alabastrum(tetraploid) 1	36.216
	CNS0095605	Slightly white alabastrum(tetraploid) 2	36.423
	CNS0095606	Slightly white alabastrum(tetraploid) 3	49.548
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.053
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.648
	CNS0095609	Whole white alabastrum(tetraploid) 3	40.404
	CNS0095610	Silvery flower (tetraploid) 1	85.700
	CNS0095611	Silvery flower (tetraploid) 2	53.135
	CNS0095612	Silvery flower (tetraploid) 3	64.740
	CNS0095613	Golden flower (tetraploid) 1	29.052
	CNS0095614	Golden flower (tetraploid) 2	39.613
	CNS0095615	Golden flower (tetraploid) 3	29.617
CRA001975	CRR073297	Stem 1	8.463
	CRR073298	Stem 2	7.451
	CRR073299	Stem 3	10.481
	CRR073300	Leaf 1	17.632
	CRR073301	Leaf 2	16.566
	CRR073302	Leaf 3	12.808
	CRR073303	Juvenile bud 1	17.610
	CRR073304	Juvenile bud 2	21.753
	CRR073305	Juvenile bud 3	21.184
	CRR073306	Third green 1	4.817
	CRR073307	Third green 2	5.339
	CRR073308	Third green 3	2.444
	CRR073309	Second white 1	25.692
	CRR073310	Second white 2	17.535
	CRR073311	Second white 3	12.064
	CRR073312	Silver flowering 1	7.172
	CRR073313	Silver flowering 2	11.169
	CRR073314	Silver flowering 3	9.434
	CRR073315	Gold flowering 1	6.884
	CRR073316	Gold flowering 2	3.086
	CRR073317	Gold flowering 3	2.826
	CRR073318	Tawny withering 1	11.082
	CRR073319	Tawny withering 2	33.423
	CRR073320	Tawny withering 3	4.027