Gene detail

Detail information of GWHGAAZE015511

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006448999.1	1.21473E-23	hypothetical protein CICLE_v10015157mg [Citrus clementina]
Swissprot	tr\|Q93VD3\|CIPKN_ARATH	4E-21	CBL-interacting serine/threonine-protein kinase 23
trEMBL	tr\|V4W7S5\|V4W7S5_9ROSI	5E-24	Uncharacterized protein {ECO:0000313\|EMBL:ESR62239.1}
TAIR10	AT1G30270.1	1E-18	CBL-interacting protein kinase 23

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	45064669	45066232	+
GWHAAZE00000004	mRNA	45064669	45066232	+
GWHAAZE00000004	exon	45064669	45064677	+
GWHAAZE00000004	exon	45065254	45065365	+
GWHAAZE00000004	exon	45065517	45065551	+
GWHAAZE00000004	exon	45065899	45066010	+
GWHAAZE00000004	exon	45066069	45066142	+
GWHAAZE00000004	exon	45066230	45066232	+
GWHAAZE00000004	CDS	45064669	45064677	+
GWHAAZE00000004	CDS	45065254	45065365	+
GWHAAZE00000004	CDS	45065517	45065551	+
GWHAAZE00000004	CDS	45065899	45066010	+
GWHAAZE00000004	CDS	45066069	45066142	+
GWHAAZE00000004	CDS	45066230	45066232	+

Transcript Sequence
>GWHTAAZE015527 ATGTATGAGTCTTCTAGAGGTAGTCTAAAAGAAGATGAAGCGAGAAAGTATTTTCAGCAACTTGTTAATGCTGTGGATTACTGCCATAGCCGAGGTGTTTGCCATAGAGATCTCAAGGCAAATTTTGGATTGAGTGCACTACCACAGCAAGTTCGATTAAAAAAAATCCTTTTGCCATGTATTCAGATGAAGCTTCATGGGGAGAAGACTAGGTGCAAGGGTCACCTATCTGTCTCAACAGAGGTATGCTTCTCCCAAGCACATTTTAATTTTGTGGTAGCCCCATCGCTTTTCATGGTTGAGCTTCGCAAGGCTGGAGGAGATACCTTAGAATTTCACAAGTGA

Network for GWHGAAZE015511

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	5	40	5.40E-10

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CAMK_CAMKL-CHK1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.264
	SRR3591706	second leaf	2.454
	SRR3591707	mature leaf	1.994
	SRR3591708	Shoot apex	3.872
	SRR3591709	Stem	1.120
	SRR3591710	White floral bud	1.491
	SRR3591711	White flower	0.547
	SRR3591712	Green floral bud	3.373
	SRR3591713	Yellow flower	0.223
SRP173429	SRR8316895	Juvenile bud stage	0.846
	SRR8316896	Juvenile bud stage	1.576
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.245
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.263
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.129
	SRR6706287	Light intensity 50%	0.037
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.693
	CNS0095593	Slightly white alabastrum(diploid) 2	0.040
	CNS0095594	Slightly white alabastrum(diploid) 3	0.780
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.069
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.913
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.733
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.197
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.735
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.053
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.482
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.290
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.319
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.161
	CRR073298	Stem 2	0.579
	CRR073299	Stem 3	0.335
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.028
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000