Gene detail

Detail information of GWHGAAZE015324

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006579812.1	7.77963E-52	PREDICTED: CDPK-related kinase 5-like isoform X2 [Glycine max]
Swissprot	tr\|Q9LJL9\|CAMK2_ARATH	4E-50	CDPK-related kinase 2
trEMBL	tr\|D7MYC3\|D7MYC3_ARALL	1E-51	Putative uncharacterized protein {ECO:0000313\|EMBL:EFH38458.1}
TAIR10	AT3G19100.1	3E-43	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	31565415	31565861	+
GWHAAZE00000004	mRNA	31565415	31565861	+
GWHAAZE00000004	exon	31565415	31565499	+
GWHAAZE00000004	exon	31565599	31565861	+
GWHAAZE00000004	CDS	31565415	31565499	+
GWHAAZE00000004	CDS	31565599	31565861	+

Transcript Sequence
>GWHTAAZE015340 ATGCAGAATTCCTTGTTCACCTCCAGGGATGAAAAGTCCCTGTGTAAAGTTATAGACTTTGGCATATCAGATTTGGTAAGACCAGATGAAAAACTTAATGGCATTATTGGAAGTGCGTACTATGTGGCACCTGAAGTTTTATTCAAACTTTACAGCACAGAGGCCGATGTACGGAGTATTGGCATTATAGCATACATTCCTTTATGTGGTAGTCGCCCGTTTTGGGAACGCACTGAGTTTGGAATTTTCCGGGCTGTTCCAAAAGTTAATCCAAGTTTTGATGAAGCACCTTGGCCCATATTGTCTTCAAAGGCAAAGGATTTTGTTAAGACCCCGGGAAACGAATAG

Network for GWHGAAZE015324

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	3	110	9.30E-15

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	CAMK_CDPK

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.841
	SRR3591706	second leaf	2.651
	SRR3591707	mature leaf	2.844
	SRR3591708	Shoot apex	0.937
	SRR3591709	Stem	2.676
	SRR3591710	White floral bud	0.807
	SRR3591711	White flower	0.119
	SRR3591712	Green floral bud	1.327
	SRR3591713	Yellow flower	0.417
SRP173429	SRR8316895	Juvenile bud stage	2.425
	SRR8316896	Juvenile bud stage	2.007
	SRR8316897	Juvenile bud stage	0.839
	SRR8316894	Third green stage	1.059
	SRR8316900	Third green stage	3.342
	SRR8316901	Third green stage	2.325
	SRR8316898	Complete white stage	1.688
	SRR8316899	Complete white stage	9.306
	SRR8316903	Complete white stage	1.938
	SRR8316902	Silver flowering stage	0.360
	SRR8316904	Silver flowering stage	2.013
	SRR8316905	Silver flowering stage	0.459
	SRR8316906	Gold flowering stage	0.774
	SRR8316907	Gold flowering stage	0.633
	SRR8316908	Gold flowering stage	0.781
SRP132670	SRR6706286	Control	3.123
	SRR6706287	Light intensity 50%	3.953
	SRR6706288	Light intensity 20%	4.133
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.455
	CNS0095593	Slightly white alabastrum(diploid) 2	1.500
	CNS0095594	Slightly white alabastrum(diploid) 3	0.606
	CNS0095595	Whole white alabastrum(diploid) 2	1.401
	CNS0095596	Whole white alabastrum(diploid) 3	1.079
	CNS0095597	Whole white alabastrum(diploid) 4	1.288
	CNS0095598	Silvery flower (diploied) 1	1.149
	CNS0095599	Silvery flower (diploied) 2	1.671
	CNS0095600	Silvery flower (diploied) 3	2.714
	CNS0095601	Golden flower (diploid) 1	1.538
	CNS0095602	Golden flower (diploid) 2	1.941
	CNS0095603	Golden flower (diploid) 3	1.970
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.562
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.888
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.785
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.558
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.063
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.487
	CNS0095610	Silvery flower (tetraploid) 1	5.911
	CNS0095611	Silvery flower (tetraploid) 2	10.230
	CNS0095612	Silvery flower (tetraploid) 3	3.294
	CNS0095613	Golden flower (tetraploid) 1	1.586
	CNS0095614	Golden flower (tetraploid) 2	3.819
	CNS0095615	Golden flower (tetraploid) 3	1.322
CRA001975	CRR073297	Stem 1	3.644
	CRR073298	Stem 2	3.367
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	3.284
	CRR073301	Leaf 2	1.393
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.002
	CRR073316	Gold flowering 2	1.983
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.830
	CRR073319	Tawny withering 2	1.708
	CRR073320	Tawny withering 3	0.067