Gene detail

Detail information of GWHGAAZE015127

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011085905.1	2.43547E-48	PREDICTED: ethylene-responsive transcription factor 1B-like [Sesamum indicum]
Swissprot	tr\|Q8LDC8\|ERF92_ARATH	3E-41	Ethylene-responsive transcription factor 1B
trEMBL	tr\|A0A072VLN9\|A0A072VLN9_MEDTR	2E-46	Ethylene-responsive transcription factor 1B {ECO:0000313\|EMBL:KEH42541.1}
TAIR10	AT3G23240.1	2E-29	ethylene response factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	25639524	25640096	-
GWHAAZE00000004	mRNA	25639524	25640096	-
GWHAAZE00000004	exon	25639524	25640096	-
GWHAAZE00000004	CDS	25639524	25640096	-

Transcript Sequence
>GWHTAAZE015143 ATGGATTCTTCTTTCCCTCAATACCACAGCTTGCAATTCTGTCCCAACTCATCCCAATCATATCCCGTACCACAAATATCATTTTCCGCCCCTGATCCAGAACCCATTTCCCCAAACATATTCAGGAAAGAACAGTACTCGGCTATACCCGCAGCCAAACAGGGGGGACCCACCACCACCACCAGGAGGCAGTACATAGGGGTCCGGAAGCGGCCTTGGGGCAAATACGCAGCGGAGATAAGGGATTCTAGCAGGGGCGGAGCTAGGGTTTGGCTCGGCACATTCAACACAGCCGAGGAGGCGGCTCTGGTCTATGACCAGGCTGCGCTCTCCCTGCGGGGCCCGCTTGGACCTCTGAATTTTCCAGCGGCAAGGGTGGAGGAATCACTGAGAGAAATGAAATATTGCTGTAAAGAGGGGCTTTCCGCGGCCGAATCCCTAAAAGAGACACACTTGAAGAGAAGGAAAAGCAAGAAAGAAGAAAAAATAGTTGTGGAAAATGATAACGATGATGATAATATGTTGGTTTTGGAGGACTTGGGAGTTGAGTTGTTAGAGGAAATGTTGGCATGA

Network for GWHGAAZE015127

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	65	114	9.60E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
K14516	ERF1	MAPK signaling pathway - plant	map04016
K14516	ERF1	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.574
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.979
	SRR3591713	Yellow flower	0.457
SRP173429	SRR8316895	Juvenile bud stage	0.134
	SRR8316896	Juvenile bud stage	0.327
	SRR8316897	Juvenile bud stage	0.047
	SRR8316894	Third green stage	0.030
	SRR8316900	Third green stage	0.742
	SRR8316901	Third green stage	1.095
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.563
	SRR6706287	Light intensity 50%	0.415
	SRR6706288	Light intensity 20%	0.170
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.273
	CNS0095593	Slightly white alabastrum(diploid) 2	0.350
	CNS0095594	Slightly white alabastrum(diploid) 3	0.700
	CNS0095595	Whole white alabastrum(diploid) 2	1.997
	CNS0095596	Whole white alabastrum(diploid) 3	0.907
	CNS0095597	Whole white alabastrum(diploid) 4	1.198
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.095
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.499
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.546
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.415
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.903
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.665
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.050
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.099
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.955
	CRR073298	Stem 2	0.035
	CRR073299	Stem 3	0.656
	CRR073300	Leaf 1	0.125
	CRR073301	Leaf 2	0.174
	CRR073302	Leaf 3	0.243
	CRR073303	Juvenile bud 1	0.077
	CRR073304	Juvenile bud 2	0.138
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.154
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.744
	CRR073319	Tawny withering 2	1.238
	CRR073320	Tawny withering 3	0.035