Gene detail

Detail information of GWHGAAZE015054

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAQ91580.1	1.72351E-19	photosystem II reaction center protein D1 [Chlamydomonas sp. CCMP1619]
Swissprot	tr\|A9L976\|PSBA_LEMMI	1E-20	Photosystem II protein D1 {ECO:0000255\|HAMAP-Rule:MF_01379} (Precursor)
trEMBL	tr\|Q6EI11\|Q6EI11_9CHLO	6E-20	Photosystem II reaction center protein D1 {ECO:0000313\|EMBL:AAQ91580.1} (Fragment)
TAIR10	ATCG00020.1	2E-18	photosystem II reaction center protein A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	23942041	23943756	-
GWHAAZE00000004	mRNA	23942041	23943756	-
GWHAAZE00000004	exon	23942041	23942427	-
GWHAAZE00000004	exon	23942655	23942806	-
GWHAAZE00000004	exon	23943528	23943756	-
GWHAAZE00000004	CDS	23943528	23943756	-
GWHAAZE00000004	CDS	23942655	23942806	-
GWHAAZE00000004	CDS	23942041	23942427	-

Transcript Sequence
>GWHTAAZE015068 ATGATCCCACTGCTTTTCAAAACTCCTTATGTTCGTGATTTAGTAAACACTTCTTGCTTGATCTGCTTCTTGGTGGGTCACTTGAAGAAGCTTCACCTCTTGGATCTAACTACGCTAATCCACCTAAACCGCTCATCAAAGTTAGCGCAAGGGGCATCTATGGACGATTGCAAGGTGTCAGGCAGTGATAATCCTTTGGTGCACAATCTCGAGTTTCGCCATTCATTAGGCGTAGCTGGGCTATTCGGTGGCTCCCTATTCGGTGCTATGTGTGATTCCTTGGTAACCTCTAGTTTGATCAGGGAAACGACAATAAATGAATCTGCTAATGAAGGTTACAGATTCAGTCAAGAAGAAGAAACTAATAATATCGTAGCGCTTCAACTTCTTCCACATGGGCTCGGTCCTCCATGCCATAATCTCCACCATAAGTGTGGTGGTCTACTTCTGCTGCTTCGTGATGGGCTTCGGTCCCATCCCCAACATTCTATGCTCAGAGATCTTTCCTACACGCGTTCGAGGCATTTGCATTGCTATTTGTGCCTTAACATTCTGGTGCGGGGACATTCTTGTCACTTACTCCCTCCCTATTATGCTCAATTCAATCGGCCTAGGTGGTGTTTTGGCATATACGCAATTGTATGCGTTATCTCATGGATTTTCGTGTTCTTGAAAGTTCCGGAAACAAAGGGAATGCCTCTTGAAGTCATTACCGAGTTCTTTGCTGTTGGCGCGAGGCAATCAGCTGACGCTTCTAGAACAAACTGA

Network for GWHGAAZE015054

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00124.20	Photo_RC	74	121	6.00E-07
PF00083.25	Sugar_tr	194	241	9.40E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02703	psbA	Metabolic pathways	map01100
K02703	psbA	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009772	biological_process	photosynthetic electron transport in photosystem II
GO:0019684	biological_process	photosynthesis, light reaction
GO:0055085	biological_process	transmembrane transport
GO:0016021	cellular_component	integral component of membrane
GO:0045156	molecular_function	electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity
GO:0022857	molecular_function	transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.090
	SRR3591706	second leaf	0.402
	SRR3591707	mature leaf	0.059
	SRR3591708	Shoot apex	1.324
	SRR3591709	Stem	2.712
	SRR3591710	White floral bud	0.364
	SRR3591711	White flower	0.115
	SRR3591712	Green floral bud	36.185
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	15.930
	SRR8316896	Juvenile bud stage	48.715
	SRR8316897	Juvenile bud stage	25.112
	SRR8316894	Third green stage	14.327
	SRR8316900	Third green stage	31.272
	SRR8316901	Third green stage	41.897
	SRR8316898	Complete white stage	0.053
	SRR8316899	Complete white stage	0.286
	SRR8316903	Complete white stage	0.093
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.073
	SRR8316905	Silver flowering stage	0.241
	SRR8316906	Gold flowering stage	0.053
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	10.333
	SRR6706287	Light intensity 50%	8.184
	SRR6706288	Light intensity 20%	7.974
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	70.548
	CNS0095593	Slightly white alabastrum(diploid) 2	47.641
	CNS0095594	Slightly white alabastrum(diploid) 3	85.092
	CNS0095595	Whole white alabastrum(diploid) 2	47.138
	CNS0095596	Whole white alabastrum(diploid) 3	73.078
	CNS0095597	Whole white alabastrum(diploid) 4	44.628
	CNS0095598	Silvery flower (diploied) 1	0.064
	CNS0095599	Silvery flower (diploied) 2	0.672
	CNS0095600	Silvery flower (diploied) 3	0.101
	CNS0095601	Golden flower (diploid) 1	0.295
	CNS0095602	Golden flower (diploid) 2	0.221
	CNS0095603	Golden flower (diploid) 3	0.306
	CNS0095604	Slightly white alabastrum(tetraploid) 1	77.985
	CNS0095605	Slightly white alabastrum(tetraploid) 2	83.164
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.429
	CNS0095607	Whole white alabastrum(tetraploid) 1	76.199
	CNS0095608	Whole white alabastrum(tetraploid) 2	51.713
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.854
	CNS0095610	Silvery flower (tetraploid) 1	0.004
	CNS0095611	Silvery flower (tetraploid) 2	0.051
	CNS0095612	Silvery flower (tetraploid) 3	0.267
	CNS0095613	Golden flower (tetraploid) 1	0.025
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.002
CRA001975	CRR073297	Stem 1	21.526
	CRR073298	Stem 2	25.160
	CRR073299	Stem 3	15.659
	CRR073300	Leaf 1	28.885
	CRR073301	Leaf 2	30.080
	CRR073302	Leaf 3	20.478
	CRR073303	Juvenile bud 1	6.603
	CRR073304	Juvenile bud 2	2.637
	CRR073305	Juvenile bud 3	0.703
	CRR073306	Third green 1	0.254
	CRR073307	Third green 2	0.409
	CRR073308	Third green 3	0.335
	CRR073309	Second white 1	0.031
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.017
	CRR073312	Silver flowering 1	0.562
	CRR073313	Silver flowering 2	0.246
	CRR073314	Silver flowering 3	0.102
	CRR073315	Gold flowering 1	0.736
	CRR073316	Gold flowering 2	0.094
	CRR073317	Gold flowering 3	0.219
	CRR073318	Tawny withering 1	0.377
	CRR073319	Tawny withering 2	0.063
	CRR073320	Tawny withering 3	0.538