Gene detail

Detail information of GWHGAAZE015005

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABD92819.1	2.40241E-42	class Ib chitinase [Limonium bicolor]
Swissprot	tr\|P52406\|CHI4_SOLTU	1E-41	Endochitinase 4 (Precursor; Fragment)
trEMBL	tr\|Q1W6C5\|Q1W6C5_9CARY	9E-43	Class Ib chitinase {ECO:0000313\|EMBL:ABD92819.1}
TAIR10	AT3G12500.1	2E-29	basic chitinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	23102288	23103001	-
GWHAAZE00000004	mRNA	23102288	23103001	-
GWHAAZE00000004	exon	23102288	23102523	-
GWHAAZE00000004	exon	23102872	23103001	-
GWHAAZE00000004	CDS	23102872	23103001	-
GWHAAZE00000004	CDS	23102288	23102523	-

Transcript Sequence
>GWHTAAZE015019 ATGGATATGTATTTTGTAGGTGGATGGGAAGATGCACTAGATGGGCAATTTGCCTGGGGATATTGCTTCATTAGGGAACAAGGCAGTTTAGGCACCGTTATTATGGCAAAGGACCTATTCAACTCACTCATAAACAATCCAGATCTAGTAGCCATAGACCCAACCATATCTTTCAAGACAGCCATATGGTTCTGGATGACATCGCAAAAGAACAAGTCGTCGAGCCACGACGTCATCATCGGAAGATGGAGCGCATCAGAAGCGGATCGTGCTGCTGGTCGGCTCCCCGGCTATGGTGTGATCACCAACATAATCAATGGCAGGGTCAAGTGTGGCAAAGGTAGCCCCCGATGGAAGGGTGGCTAA

Network for GWHGAAZE015005

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00182.20	Glyco_hydro_19	41	115	3.20E-38

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K20547	CHIB	Metabolic pathways	map01100
		Amino sugar and nucleotide sugar metabolism	map00520
		MAPK signaling pathway - plant	map04016

Gene Ontology

GO term	Ontology	Name
GO:0006032	biological_process	chitin catabolic process
GO:0016998	biological_process	cell wall macromolecule catabolic process
GO:0004568	molecular_function	chitinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.118
	SRR8316898	Complete white stage	0.345
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.301
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.271
	SRR6706287	Light intensity 50%	0.048
	SRR6706288	Light intensity 20%	0.168
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.104
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.003
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.020
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.351
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.039
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.098
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.165
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.058
	CRR073318	Tawny withering 1	0.024
	CRR073319	Tawny withering 2	0.162
	CRR073320	Tawny withering 3	0.603