Gene detail

Detail information of GWHGAAZE014879

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011090775.1	1.0114E-122	PREDICTED: proteasome subunit beta type-1 [Sesamum indicum]
Swissprot	tr\|O82531\|PSB1_PETHY	2E-119	Proteasome subunit beta type-1
trEMBL	tr\|A0A068U0B3\|A0A068U0B3_COFCA	8E-120	Proteasome subunit beta type {ECO:0000256\|RuleBase:RU004203}
TAIR10	AT3G60820.3	4E-81	N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	20825963	20829586	+
GWHAAZE00000004	mRNA	20825963	20829586	+
GWHAAZE00000004	exon	20825963	20826009	+
GWHAAZE00000004	exon	20827118	20827199	+
GWHAAZE00000004	exon	20827577	20827706	+
GWHAAZE00000004	exon	20827781	20827923	+
GWHAAZE00000004	exon	20828008	20828094	+
GWHAAZE00000004	exon	20829512	20829586	+
GWHAAZE00000004	CDS	20825963	20826009	+
GWHAAZE00000004	CDS	20827118	20827199	+
GWHAAZE00000004	CDS	20827577	20827706	+
GWHAAZE00000004	CDS	20827781	20827923	+
GWHAAZE00000004	CDS	20828008	20828094	+
GWHAAZE00000004	CDS	20829512	20829586	+

Transcript Sequence
>GWHTAAZE014893 ATGGTGAAAGAGCAAGCTAACTGGTCTCCTTACGATAACAATGGAGGCGCCGACAAAAGTGTGATGGCCTCTTCAGGGTTTCAGGCTGATGTTAGAGCTTTGCAAAAGCACCTAGCAGCAAGGCACTTGATCTACCAGCACCAACACAACAAGCAGATGAGCTGCCCAGCAATGGCCCAGCTTCTCTCTAACACCCTCTACTACAAACGCTTCTTCCCATATTATGCTTTCAATGTTCTTAGTGGTCTCGACACTGAAGGGAAGGGTTGTGTCTTCACGTATGATGCTGTTGGATCCTACGAGAGGGTTGGGTACAGTGCTCAAGGTTCTGGTGCCACTCTCATCACACCTTTCTTGGATAACCAACTGAAATCTCCAAGTCCACTCTTACTACCGGCCAAGGATGCTGTTACTCCACTATCAGAATCTGAAGCTATTGATTTGGTAAAGACTTGTTTTGCATCGGCAACAGAGAGGGATATATACACTGGAGACAATCTGGAAATTGTTGTATTAAACTTTGACGGTATTCGCCGTGAATACATGGAGCTCAGGAAAGATTGA

Network for GWHGAAZE014879

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00227.27	Proteasome	18	171	2.60E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02732	PSMB1	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0004298	molecular_function	threonine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	74.308
	SRR3591706	second leaf	47.749
	SRR3591707	mature leaf	37.194
	SRR3591708	Shoot apex	84.540
	SRR3591709	Stem	62.640
	SRR3591710	White floral bud	70.402
	SRR3591711	White flower	84.225
	SRR3591712	Green floral bud	100.870
	SRR3591713	Yellow flower	76.740
SRP173429	SRR8316895	Juvenile bud stage	48.286
	SRR8316896	Juvenile bud stage	66.042
	SRR8316897	Juvenile bud stage	38.380
	SRR8316894	Third green stage	32.146
	SRR8316900	Third green stage	83.646
	SRR8316901	Third green stage	86.279
	SRR8316898	Complete white stage	31.129
	SRR8316899	Complete white stage	92.360
	SRR8316903	Complete white stage	38.331
	SRR8316902	Silver flowering stage	22.978
	SRR8316904	Silver flowering stage	31.411
	SRR8316905	Silver flowering stage	15.630
	SRR8316906	Gold flowering stage	48.285
	SRR8316907	Gold flowering stage	45.635
	SRR8316908	Gold flowering stage	55.117
SRP132670	SRR6706286	Control	88.974
	SRR6706287	Light intensity 50%	89.396
	SRR6706288	Light intensity 20%	102.755
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	71.494
	CNS0095593	Slightly white alabastrum(diploid) 2	63.614
	CNS0095594	Slightly white alabastrum(diploid) 3	63.863
	CNS0095595	Whole white alabastrum(diploid) 2	57.840
	CNS0095596	Whole white alabastrum(diploid) 3	66.227
	CNS0095597	Whole white alabastrum(diploid) 4	51.308
	CNS0095598	Silvery flower (diploied) 1	55.799
	CNS0095599	Silvery flower (diploied) 2	49.984
	CNS0095600	Silvery flower (diploied) 3	59.209
	CNS0095601	Golden flower (diploid) 1	45.035
	CNS0095602	Golden flower (diploid) 2	49.731
	CNS0095603	Golden flower (diploid) 3	45.703
	CNS0095604	Slightly white alabastrum(tetraploid) 1	65.334
	CNS0095605	Slightly white alabastrum(tetraploid) 2	55.958
	CNS0095606	Slightly white alabastrum(tetraploid) 3	70.638
	CNS0095607	Whole white alabastrum(tetraploid) 1	37.975
	CNS0095608	Whole white alabastrum(tetraploid) 2	37.833
	CNS0095609	Whole white alabastrum(tetraploid) 3	54.962
	CNS0095610	Silvery flower (tetraploid) 1	55.034
	CNS0095611	Silvery flower (tetraploid) 2	58.307
	CNS0095612	Silvery flower (tetraploid) 3	52.113
	CNS0095613	Golden flower (tetraploid) 1	40.564
	CNS0095614	Golden flower (tetraploid) 2	43.352
	CNS0095615	Golden flower (tetraploid) 3	49.777
CRA001975	CRR073297	Stem 1	83.891
	CRR073298	Stem 2	84.637
	CRR073299	Stem 3	98.293
	CRR073300	Leaf 1	84.924
	CRR073301	Leaf 2	91.404
	CRR073302	Leaf 3	106.951
	CRR073303	Juvenile bud 1	85.174
	CRR073304	Juvenile bud 2	85.328
	CRR073305	Juvenile bud 3	98.139
	CRR073306	Third green 1	40.028
	CRR073307	Third green 2	40.158
	CRR073308	Third green 3	47.348
	CRR073309	Second white 1	60.741
	CRR073310	Second white 2	45.443
	CRR073311	Second white 3	40.135
	CRR073312	Silver flowering 1	36.548
	CRR073313	Silver flowering 2	40.965
	CRR073314	Silver flowering 3	38.501
	CRR073315	Gold flowering 1	58.651
	CRR073316	Gold flowering 2	62.118
	CRR073317	Gold flowering 3	57.214
	CRR073318	Tawny withering 1	83.574
	CRR073319	Tawny withering 2	63.833
	CRR073320	Tawny withering 3	102.189