Gene detail

Detail information of GWHGAAZE014717

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004231147.1	1.62826E-44	PREDICTED: ethylene-responsive transcription factor 13-like [Solanum lycopersicum]
Swissprot	tr\|Q40479\|ERF2_TOBAC	1E-34	Ethylene-responsive transcription factor 2
trEMBL	tr\|K4AYX1\|K4AYX1_SOLLC	6E-45	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g090300.2.1}
TAIR10	AT2G44840.1	2E-22	ethylene-responsive element binding factor 13

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	17247043	17247609	-
GWHAAZE00000004	mRNA	17247043	17247609	-
GWHAAZE00000004	exon	17247043	17247609	-
GWHAAZE00000004	CDS	17247043	17247609	-

Transcript Sequence
>GWHTAAZE014731 ATGTACCAAAACACAATCTCAGAATCTGAGTTTGCTCTGCTCGAATCCATTCGCCTTCATCTTTTTGATGATTCTTCTTCGGATCATAGTCCGATTATTTTGTCCGACAAGTCATCAACTTGTTGTGACTGCTCAAGCTTGAGCTTTGACAGTCTCTTCTCGACAGAGAGTTGGGCAGAGACACTTTCAAAACTATCATTGTCATCAATAGCAGTAGAGACTTCAGAGTCTAGTGAGGACTCGTCATCGATGGAAATAGTGGCGGCGGCGGAGTGGAGGCGATATAGAGGGGTGAGGCGGCGGCCTTGGGGGAAGTTTTCAGCCGAGATAAGGAATCCGGAGAAAAAGGGGGCCAGGATCTGGCTTGGGACCTACGATACGCCTGAGGAAGCTGCATTCGCTTATGATAGGGCGGCTTTTAAAATACGTGGCTCACGTGCATTGGTTAATTTTCCTCACCTTATCAGTTCCGATGACACCTCACGAACCGTGAAGGTGTCTCATAAGAAGCGCCATTCATCATTGCTATCTTTTGATGATGTAGATTCAAAGAGGAGGAGGACGTGA

Network for GWHGAAZE014717

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	94	144	1.60E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.464
	SRR3591706	second leaf	2.576
	SRR3591707	mature leaf	0.913
	SRR3591708	Shoot apex	0.803
	SRR3591709	Stem	14.795
	SRR3591710	White floral bud	0.186
	SRR3591711	White flower	0.699
	SRR3591712	Green floral bud	0.451
	SRR3591713	Yellow flower	0.155
SRP173429	SRR8316895	Juvenile bud stage	3.583
	SRR8316896	Juvenile bud stage	5.482
	SRR8316897	Juvenile bud stage	0.095
	SRR8316894	Third green stage	1.575
	SRR8316900	Third green stage	1.555
	SRR8316901	Third green stage	1.512
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	3.827
	SRR8316903	Complete white stage	0.249
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.121
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.083
SRP132670	SRR6706286	Control	1.458
	SRR6706287	Light intensity 50%	2.081
	SRR6706288	Light intensity 20%	1.178
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.038
	CNS0095593	Slightly white alabastrum(diploid) 2	9.408
	CNS0095594	Slightly white alabastrum(diploid) 3	7.856
	CNS0095595	Whole white alabastrum(diploid) 2	7.973
	CNS0095596	Whole white alabastrum(diploid) 3	0.661
	CNS0095597	Whole white alabastrum(diploid) 4	2.656
	CNS0095598	Silvery flower (diploied) 1	5.789
	CNS0095599	Silvery flower (diploied) 2	7.926
	CNS0095600	Silvery flower (diploied) 3	0.997
	CNS0095601	Golden flower (diploid) 1	3.363
	CNS0095602	Golden flower (diploid) 2	1.627
	CNS0095603	Golden flower (diploid) 3	2.059
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.397
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.279
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.637
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.667
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.046
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.237
	CNS0095610	Silvery flower (tetraploid) 1	0.026
	CNS0095611	Silvery flower (tetraploid) 2	0.975
	CNS0095612	Silvery flower (tetraploid) 3	0.472
	CNS0095613	Golden flower (tetraploid) 1	0.286
	CNS0095614	Golden flower (tetraploid) 2	0.093
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	6.726
	CRR073298	Stem 2	4.522
	CRR073299	Stem 3	6.473
	CRR073300	Leaf 1	2.466
	CRR073301	Leaf 2	2.168
	CRR073302	Leaf 3	1.214
	CRR073303	Juvenile bud 1	0.165
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.308
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.569
	CRR073316	Gold flowering 2	2.257
	CRR073317	Gold flowering 3	1.577
	CRR073318	Tawny withering 1	13.375
	CRR073319	Tawny withering 2	12.832
	CRR073320	Tawny withering 3	7.249