Gene detail

Detail information of GWHGAAZE014700

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP32128.1	5.14877E-34	hypothetical protein JCGZ_12589 [Jatropha curcas]
trEMBL	tr\|A0A067KAT2\|A0A067KAT2_JATCU	2E-34	Uncharacterized protein {ECO:0000313\|EMBL:KDP32128.1}
TAIR10	AT5G65760.1	6E-30	Serine carboxypeptidase S28 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	16838903	16839243	-
GWHAAZE00000004	mRNA	16838903	16839243	-
GWHAAZE00000004	exon	16838903	16838982	-
GWHAAZE00000004	exon	16839096	16839243	-
GWHAAZE00000004	CDS	16839096	16839243	-
GWHAAZE00000004	CDS	16838903	16838982	-

Transcript Sequence
>GWHTAAZE014714 ATGCCATATGGAAGTAGAGATGAGGCATATAAGAACTCCACTACTTTAGCCCATCTAACGGCAGAGCAAGCACTTGCAGATTTTGCGGTATTGCTCACTGACCTTAAAAGAAATTTGTCTGTGGAGGCTTGCCCTGTAGTGCTATTGGTGAATGGAATAATGTTAACAGCATGGATGAGGCTCAAGTATCCTCATATGGCCATCGGTGCACTTGCTTCTTCAGTTTGA

Network for GWHGAAZE014700

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05577.13	Peptidase_S28	12	74	1.80E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01285	PRCP	Renin-angiotensin system	map04614
K01285	PRCP	Protein digestion and absorption	map04974

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0008236	molecular_function	serine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.783
	SRR3591706	second leaf	0.124
	SRR3591707	mature leaf	2.407
	SRR3591708	Shoot apex	1.971
	SRR3591709	Stem	4.174
	SRR3591710	White floral bud	4.074
	SRR3591711	White flower	6.383
	SRR3591712	Green floral bud	6.271
	SRR3591713	Yellow flower	1.531
SRP173429	SRR8316895	Juvenile bud stage	2.069
	SRR8316896	Juvenile bud stage	1.976
	SRR8316897	Juvenile bud stage	2.161
	SRR8316894	Third green stage	1.521
	SRR8316900	Third green stage	2.966
	SRR8316901	Third green stage	2.213
	SRR8316898	Complete white stage	0.266
	SRR8316899	Complete white stage	3.881
	SRR8316903	Complete white stage	0.342
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.291
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.473
	SRR8316907	Gold flowering stage	0.378
	SRR8316908	Gold flowering stage	0.345
SRP132670	SRR6706286	Control	0.825
	SRR6706287	Light intensity 50%	1.408
	SRR6706288	Light intensity 20%	1.377
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.804
	CNS0095593	Slightly white alabastrum(diploid) 2	2.058
	CNS0095594	Slightly white alabastrum(diploid) 3	1.789
	CNS0095595	Whole white alabastrum(diploid) 2	1.503
	CNS0095596	Whole white alabastrum(diploid) 3	1.406
	CNS0095597	Whole white alabastrum(diploid) 4	1.133
	CNS0095598	Silvery flower (diploied) 1	2.974
	CNS0095599	Silvery flower (diploied) 2	2.642
	CNS0095600	Silvery flower (diploied) 3	1.781
	CNS0095601	Golden flower (diploid) 1	1.249
	CNS0095602	Golden flower (diploid) 2	1.651
	CNS0095603	Golden flower (diploid) 3	1.405
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.460
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.596
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.245
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.857
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.193
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.826
	CNS0095610	Silvery flower (tetraploid) 1	1.050
	CNS0095611	Silvery flower (tetraploid) 2	2.610
	CNS0095612	Silvery flower (tetraploid) 3	0.726
	CNS0095613	Golden flower (tetraploid) 1	1.183
	CNS0095614	Golden flower (tetraploid) 2	1.152
	CNS0095615	Golden flower (tetraploid) 3	0.112
CRA001975	CRR073297	Stem 1	3.023
	CRR073298	Stem 2	1.606
	CRR073299	Stem 3	0.389
	CRR073300	Leaf 1	3.560
	CRR073301	Leaf 2	1.730
	CRR073302	Leaf 3	0.640
	CRR073303	Juvenile bud 1	0.631
	CRR073304	Juvenile bud 2	0.124
	CRR073305	Juvenile bud 3	2.129
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.169
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.025
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.047
	CRR073319	Tawny withering 2	0.185
	CRR073320	Tawny withering 3	0.107