Gene detail

Detail information of GWHGAAZE014661

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010102767.1	6.51249E-98	60S ribosomal protein L26-1 [Morus notabilis]
Swissprot	tr\|P51414\|RL261_ARATH	4E-92	60S ribosomal protein L26-1
trEMBL	tr\|W9RS71\|W9RS71_9ROSA	2E-98	60S ribosomal protein L26-1 {ECO:0000313\|EMBL:EXB94051.1}
TAIR10	AT3G49910.1	8E-55	Translation protein SH3-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	16259372	16259812	-
GWHAAZE00000004	mRNA	16259372	16259812	-
GWHAAZE00000004	exon	16259372	16259812	-
GWHAAZE00000004	CDS	16259372	16259812	-

Transcript Sequence
>GWHTAAZE014675 ATGAAGTACAATCCTAGGGTTTCCAGCTCCCGCCGGAAGAACAGAAAGGCTCACTTCTCCGCTCCCTCTAGCGTCCGCCGCGTGTTGATGAGCGCCCCACTATCCGGCGACCTCCGCTCCAAGTACAACGTCCGTTCGATGCCGGTGCGCAAGGACGACGAGGTCCAGGTGGTCCGAGGCACCTACAAAGGCCGCGAGGGCAAGGTTGTCCAAGTCTACCGTCGGAAATGGGTGATCCACATCGAGCGTATCACTCGGGAGAAGGTTAACGGATCCACCGTCAACGTCGGCATCAATCCGTCAAAGTGCGTCATCACGAAGCTTCGCCTCGATAAGGACCGTAAGTCTCTGCTGGATCGTAAGGCTAAGGGACGTGCTGCTGCTGATAAGGACAAGGGGACCAAGTTTACTGCTGAAGATATAATGCAGAGCGTGGACTGA

Network for GWHGAAZE014661

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16906.6	Ribosomal_L26	8	121	1.30E-37
PF00467.30	KOW	51	82	2.90E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02898	RP-L26e, RPL26	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015934	cellular_component	large ribosomal subunit
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	653.126
	SRR3591706	second leaf	268.262
	SRR3591707	mature leaf	150.760
	SRR3591708	Shoot apex	843.779
	SRR3591709	Stem	346.566
	SRR3591710	White floral bud	350.458
	SRR3591711	White flower	347.236
	SRR3591712	Green floral bud	709.516
	SRR3591713	Yellow flower	183.893
SRP173429	SRR8316895	Juvenile bud stage	348.366
	SRR8316896	Juvenile bud stage	463.670
	SRR8316897	Juvenile bud stage	272.506
	SRR8316894	Third green stage	185.310
	SRR8316900	Third green stage	732.395
	SRR8316901	Third green stage	730.638
	SRR8316898	Complete white stage	126.692
	SRR8316899	Complete white stage	625.818
	SRR8316903	Complete white stage	170.505
	SRR8316902	Silver flowering stage	97.862
	SRR8316904	Silver flowering stage	85.579
	SRR8316905	Silver flowering stage	39.963
	SRR8316906	Gold flowering stage	123.811
	SRR8316907	Gold flowering stage	130.397
	SRR8316908	Gold flowering stage	198.806
SRP132670	SRR6706286	Control	559.835
	SRR6706287	Light intensity 50%	598.844
	SRR6706288	Light intensity 20%	651.183
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	721.226
	CNS0095593	Slightly white alabastrum(diploid) 2	907.980
	CNS0095594	Slightly white alabastrum(diploid) 3	669.738
	CNS0095595	Whole white alabastrum(diploid) 2	642.436
	CNS0095596	Whole white alabastrum(diploid) 3	743.245
	CNS0095597	Whole white alabastrum(diploid) 4	532.306
	CNS0095598	Silvery flower (diploied) 1	417.619
	CNS0095599	Silvery flower (diploied) 2	380.599
	CNS0095600	Silvery flower (diploied) 3	284.534
	CNS0095601	Golden flower (diploid) 1	303.494
	CNS0095602	Golden flower (diploid) 2	265.274
	CNS0095603	Golden flower (diploid) 3	248.553
	CNS0095604	Slightly white alabastrum(tetraploid) 1	750.541
	CNS0095605	Slightly white alabastrum(tetraploid) 2	729.295
	CNS0095606	Slightly white alabastrum(tetraploid) 3	956.757
	CNS0095607	Whole white alabastrum(tetraploid) 1	426.057
	CNS0095608	Whole white alabastrum(tetraploid) 2	424.877
	CNS0095609	Whole white alabastrum(tetraploid) 3	733.973
	CNS0095610	Silvery flower (tetraploid) 1	256.172
	CNS0095611	Silvery flower (tetraploid) 2	218.250
	CNS0095612	Silvery flower (tetraploid) 3	160.332
	CNS0095613	Golden flower (tetraploid) 1	116.485
	CNS0095614	Golden flower (tetraploid) 2	216.947
	CNS0095615	Golden flower (tetraploid) 3	80.459
CRA001975	CRR073297	Stem 1	542.926
	CRR073298	Stem 2	568.129
	CRR073299	Stem 3	694.088
	CRR073300	Leaf 1	590.628
	CRR073301	Leaf 2	635.170
	CRR073302	Leaf 3	835.450
	CRR073303	Juvenile bud 1	700.611
	CRR073304	Juvenile bud 2	680.482
	CRR073305	Juvenile bud 3	636.911
	CRR073306	Third green 1	80.285
	CRR073307	Third green 2	88.259
	CRR073308	Third green 3	100.023
	CRR073309	Second white 1	63.187
	CRR073310	Second white 2	50.826
	CRR073311	Second white 3	30.243
	CRR073312	Silver flowering 1	42.655
	CRR073313	Silver flowering 2	89.523
	CRR073314	Silver flowering 3	73.314
	CRR073315	Gold flowering 1	193.779
	CRR073316	Gold flowering 2	213.588
	CRR073317	Gold flowering 3	228.771
	CRR073318	Tawny withering 1	560.968
	CRR073319	Tawny withering 2	432.059
	CRR073320	Tawny withering 3	554.711