Gene detail

Detail information of GWHGAAZE014592

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP31925.1	5.16843E-28	hypothetical protein JCGZ_12386 [Jatropha curcas]
Swissprot	tr\|Q9C5I3\|ERF76_ARATH	7E-23	Ethylene-responsive transcription factor 11
trEMBL	tr\|A0A067KI25\|A0A067KI25_JATCU	2E-28	Uncharacterized protein {ECO:0000313\|EMBL:KDP31925.1}
TAIR10	AT4G27950.1	2E-19	cytokinin response factor 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	14805757	14806188	-
GWHAAZE00000004	mRNA	14805757	14806188	-
GWHAAZE00000004	exon	14805757	14806188	-
GWHAAZE00000004	CDS	14805757	14806188	-

Transcript Sequence
>GWHTAAZE014606 ATGCAGAGGATCGGGGTGAGTCAGAAGAAGTATAGGGGAGTGAGGCAGAGGCCATCGGGGAAATGGGCGGCTGAGATACGGGACCCGATGAGGGAGAAAGGGATATGGCTCGGCACTTTCGGCACTGCTGAGGAAGCGGCCAGAGCTTACGACCTCAAGGCTATTGAGTTCCGTAAGGGCAACGCCAAGACAAATTTTCCTCTGAAGGATTACAACCATGAATTACTAAGCAATGAGAAGCAGGAGGAAAATGATCAAGTGAACGGAAACATAAAGAGTTGTGAAAATGAAACAGACGAGTCAATATTAACCGTTACGGCAACGGAAGGTGAGAGCAGTAGTAAAAGGGAAGAGGATGATCCTCTTGGTTGGATTTTCAACAACGACGAAGAATATGAGCTTCCAGAATGGAAGACGGTGGATACTCCGTGA

Network for GWHGAAZE014592

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	10	58	2.30E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.204
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.474
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.213
SRP132670	SRR6706286	Control	0.413
	SRR6706287	Light intensity 50%	1.108
	SRR6706288	Light intensity 20%	0.047
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.132
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.311
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.003
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.758
	CNS0095602	Golden flower (diploid) 2	0.236
	CNS0095603	Golden flower (diploid) 3	0.302
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.147
	CNS0095610	Silvery flower (tetraploid) 1	0.874
	CNS0095611	Silvery flower (tetraploid) 2	0.295
	CNS0095612	Silvery flower (tetraploid) 3	3.434
	CNS0095613	Golden flower (tetraploid) 1	0.564
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	1.809
CRA001975	CRR073297	Stem 1	0.775
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.142
	CRR073301	Leaf 2	0.244
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.658
	CRR073304	Juvenile bud 2	6.359
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	3.423
	CRR073307	Third green 2	1.339
	CRR073308	Third green 3	1.482
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.514
	CRR073311	Second white 3	0.191
	CRR073312	Silver flowering 1	0.833
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.366
	CRR073315	Gold flowering 1	0.187
	CRR073316	Gold flowering 2	0.838
	CRR073317	Gold flowering 3	1.526
	CRR073318	Tawny withering 1	2.094
	CRR073319	Tawny withering 2	2.357
	CRR073320	Tawny withering 3	1.263