Gene detail

Detail information of GWHGAAZE014519

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010246977.1	6.0406E-118	PREDICTED: E3 ubiquitin-protein ligase RNF185 isoform X1 [Nelumbo nucifera]
Swissprot	tr\|Q6R567\|RMA1_CAPAN	1E-27	E3 ubiquitin-protein ligase RMA1H1
trEMBL	tr\|W9RK94\|W9RK94_9ROSA	9E-118	RING finger protein 5 {ECO:0000313\|EMBL:EXB77876.1}
TAIR10	AT2G23780.1	1E-57	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	13258321	13259001	+
GWHAAZE00000004	mRNA	13258321	13259001	+
GWHAAZE00000004	exon	13258321	13259001	+
GWHAAZE00000004	CDS	13258321	13259001	+

Transcript Sequence
>GWHTAAZE014533 ATGGCAAGTAAGTTCGGTGAATCAACAAGCAGGCCGCCCCAAAGCCCACCTTTTTCCAGCAATGGCCCCAATGATGCTGGTGATTTTGAATGCAATATCTGCTTTGATTTAGCTCAAGATCCCATTGTCACCCTTTGCGGTCACCTATTTTGCTGGCCGTGTCTTTATAGATGGCTTCACCTTCACTCCCGTTCCCAAGAATGCCCTGTTTGTAAGGCCCTTATACAGGAGGAAAAGTTAGTTCCTCTTTATGGCAGAGGAAAGACATCAACGGATCCAAGATCCAAACCCATGCCCGGAGTTGAAATTCCTAATAGACCAACGGGTCAAAGACCTGAAACTGCCCCACCCCCTGAGGCAAATACCTTTCCAAATCTAGGGTTTGGACTTATGGGGGGTTCGGTTCCGATGGCAACTGCAAGGTTTGGTAACTTTGCATTTTCTGCTGGATTTGGGGGGTTGTTTCCATCTTTATTCAACATTCAGGTTCATAGATTCCCAGATGCTACTTTGTATGGTACAACATCGGGGCACCCATATGGCTTTATGGGTGGATTTCATGGGGTCCATGTTCGTAGGCATCATCCCCGGACTAGTCAAGGACAACAAGCTGATTATGTATTGAAGATGCTTCTTTTGATGATCGGTGCCTTTGTGATCCTCACGCTGATTTGGTCGTAA

Network for GWHGAAZE014519

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13923.7	zf-C3HC4_2	30	71	9.10E-10

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
K10666	RNF5	Protein processing in endoplasmic reticulum	map04141

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.340
	SRR3591706	second leaf	9.320
	SRR3591707	mature leaf	14.366
	SRR3591708	Shoot apex	14.015
	SRR3591709	Stem	27.996
	SRR3591710	White floral bud	44.519
	SRR3591711	White flower	46.248
	SRR3591712	Green floral bud	32.611
	SRR3591713	Yellow flower	39.557
SRP173429	SRR8316895	Juvenile bud stage	27.301
	SRR8316896	Juvenile bud stage	38.070
	SRR8316897	Juvenile bud stage	21.735
	SRR8316894	Third green stage	11.075
	SRR8316900	Third green stage	40.924
	SRR8316901	Third green stage	44.102
	SRR8316898	Complete white stage	26.884
	SRR8316899	Complete white stage	74.520
	SRR8316903	Complete white stage	38.493
	SRR8316902	Silver flowering stage	33.858
	SRR8316904	Silver flowering stage	34.856
	SRR8316905	Silver flowering stage	18.098
	SRR8316906	Gold flowering stage	62.508
	SRR8316907	Gold flowering stage	58.531
	SRR8316908	Gold flowering stage	74.069
SRP132670	SRR6706286	Control	43.414
	SRR6706287	Light intensity 50%	45.093
	SRR6706288	Light intensity 20%	45.369
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	34.537
	CNS0095593	Slightly white alabastrum(diploid) 2	38.363
	CNS0095594	Slightly white alabastrum(diploid) 3	34.775
	CNS0095595	Whole white alabastrum(diploid) 2	32.820
	CNS0095596	Whole white alabastrum(diploid) 3	27.339
	CNS0095597	Whole white alabastrum(diploid) 4	25.343
	CNS0095598	Silvery flower (diploied) 1	41.773
	CNS0095599	Silvery flower (diploied) 2	33.034
	CNS0095600	Silvery flower (diploied) 3	49.363
	CNS0095601	Golden flower (diploid) 1	33.925
	CNS0095602	Golden flower (diploid) 2	43.967
	CNS0095603	Golden flower (diploid) 3	41.943
	CNS0095604	Slightly white alabastrum(tetraploid) 1	48.467
	CNS0095605	Slightly white alabastrum(tetraploid) 2	46.092
	CNS0095606	Slightly white alabastrum(tetraploid) 3	61.088
	CNS0095607	Whole white alabastrum(tetraploid) 1	32.510
	CNS0095608	Whole white alabastrum(tetraploid) 2	41.596
	CNS0095609	Whole white alabastrum(tetraploid) 3	56.101
	CNS0095610	Silvery flower (tetraploid) 1	78.051
	CNS0095611	Silvery flower (tetraploid) 2	71.906
	CNS0095612	Silvery flower (tetraploid) 3	97.975
	CNS0095613	Golden flower (tetraploid) 1	54.982
	CNS0095614	Golden flower (tetraploid) 2	58.414
	CNS0095615	Golden flower (tetraploid) 3	82.112
CRA001975	CRR073297	Stem 1	32.730
	CRR073298	Stem 2	27.159
	CRR073299	Stem 3	22.110
	CRR073300	Leaf 1	35.027
	CRR073301	Leaf 2	47.331
	CRR073302	Leaf 3	31.406
	CRR073303	Juvenile bud 1	34.133
	CRR073304	Juvenile bud 2	42.548
	CRR073305	Juvenile bud 3	37.493
	CRR073306	Third green 1	176.943
	CRR073307	Third green 2	121.541
	CRR073308	Third green 3	120.135
	CRR073309	Second white 1	120.198
	CRR073310	Second white 2	94.568
	CRR073311	Second white 3	66.764
	CRR073312	Silver flowering 1	66.046
	CRR073313	Silver flowering 2	62.932
	CRR073314	Silver flowering 3	50.992
	CRR073315	Gold flowering 1	29.503
	CRR073316	Gold flowering 2	35.177
	CRR073317	Gold flowering 3	23.396
	CRR073318	Tawny withering 1	27.648
	CRR073319	Tawny withering 2	34.808
	CRR073320	Tawny withering 3	25.676