Gene detail

Detail information of GWHGAAZE014365

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011002516.1	8.4982E-47	PREDICTED: ethylene-responsive transcription factor LEP-like [Populus euphratica]
Swissprot	tr\|Q9M644\|LEP_ARATH	5E-27	Ethylene-responsive transcription factor LEP
trEMBL	tr\|B9SMB3\|B9SMB3_RICCO	2E-44	DNA binding protein, putative {ECO:0000313\|EMBL:EEF35295.1}
TAIR10	AT5G18560.1	4E-22	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	11009337	11009726	-
GWHAAZE00000004	mRNA	11009337	11009726	-
GWHAAZE00000004	exon	11009337	11009726	-
GWHAAZE00000004	CDS	11009337	11009726	-

Transcript Sequence
>GWHTAAZE014379 ATGTTTAGCAGAAAGCAAAGGAGAAGAAGCTCAAGACATTCCACCAATTACCTCGGAGTTCGCCGGAGGCCGTGGGGCCGGTTTGCGGCGGAGATTCGGAACCCTTACACTAAAGAAAGACACTGGCTAGGCACATTTGACACTGCTGAAGAAGCTGCATTGGCTTATGATCTTTCTTCCATCTCTTTTAGTGGCACTGAAAATGCTCGCACCAATTTTTGCTATCCGTTTTTTACTGTTCCGGCCCTTTCACCCCCAGCATTGCCACCTCCACCGCCACCACCCACGCCGGAGTTGGAAGAGGAGCGGTGTTGCACGGAGACAAGTTCTGCTGAAGATGACGAGTCGCTTGTTATTGCTTCTATTTTGCAGAGCTTTGCTCAAATCTAA

Network for GWHGAAZE014365

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	16	58	4.50E-11

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.937
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.138
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.259
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.531
	SRR3591713	Yellow flower	0.383
SRP173429	SRR8316895	Juvenile bud stage	0.590
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.274
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.163
	SRR8316903	Complete white stage	0.221
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.432
	SRR6706287	Light intensity 50%	0.203
	SRR6706288	Light intensity 20%	0.457
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.198
	CNS0095593	Slightly white alabastrum(diploid) 2	0.213
	CNS0095594	Slightly white alabastrum(diploid) 3	0.094
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.156
	CNS0095597	Whole white alabastrum(diploid) 4	0.883
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.407
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.110
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.143
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.031
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.393
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.130
	CRR073303	Juvenile bud 1	0.079
	CRR073304	Juvenile bud 2	0.035
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.116
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000