Gene detail

Detail information of GWHGAAZE014362

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP01168.1	3.48241E-82	unnamed protein product [Coffea canephora]
Swissprot	tr\|P32980\|ATPD_TOBAC	2E-78	ATP synthase delta chain, chloroplastic (Precursor)
trEMBL	tr\|A0A068U0N9\|A0A068U0N9_COFCA	1E-82	Coffea canephora DH200=94 genomic scaffold, scaffold_6 {ECO:0000313\|EMBL:CDP01168.1}
TAIR10	AT4G09650.1	1E-57	ATP synthase delta-subunit gene

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	10967525	10968007	-
GWHAAZE00000004	mRNA	10967525	10968007	-
GWHAAZE00000004	exon	10967525	10968007	-
GWHAAZE00000004	CDS	10967525	10968007	-

Transcript Sequence
>GWHTAAZE014376 ATGGAAAAGGTAGAAAAAATCTTCTCCGATCCCGAGGTGGTCTACTTCTTCGTAAGCCCGGTGATAGACACGGAGACGAAGCGGAAAATGATCGACGAGATTACGAACTCGTCGAATCTCCAACCACACGTATCGAATTTTCTGAATATTCTTCTGGATATGAAGAGAATCGATCTGATGAAGGATATTGTGAAGGAATTCGAGTTGACGTATAGTAAATTGACGGATACGGAGATTGCGATTGTGACTTCGGTGGCGCAATTGGAGTCGCAGCACTTGGCGCAGGTTGCGAAAGGTGTACAGAGGATTACCGGAGCGAAGAACGTAAGAATTAAGACGGTGATTGATCCGTCGTTGTTGGCTGGTTTCACAATTAGGTATGGACTATCTGGATCCAAGCTTATTGATATGAGTGTGAAGAAACAGCTTGAAGAGATAACCGAGCAGCTTGAGATTGGAGAAATTTCACTTGCTGCTGTATGA

Network for GWHGAAZE014362

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00213.19	OSCP	2	150	9.20E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02113	ATPF1D, atpH	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0016020	cellular_component	membrane
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	200.998
	SRR3591706	second leaf	1060.660
	SRR3591707	mature leaf	989.620
	SRR3591708	Shoot apex	367.348
	SRR3591709	Stem	140.663
	SRR3591710	White floral bud	70.184
	SRR3591711	White flower	61.291
	SRR3591712	Green floral bud	43.868
	SRR3591713	Yellow flower	26.291
SRP173429	SRR8316895	Juvenile bud stage	74.390
	SRR8316896	Juvenile bud stage	61.121
	SRR8316897	Juvenile bud stage	56.810
	SRR8316894	Third green stage	30.264
	SRR8316900	Third green stage	88.982
	SRR8316901	Third green stage	78.311
	SRR8316898	Complete white stage	97.307
	SRR8316899	Complete white stage	78.331
	SRR8316903	Complete white stage	127.056
	SRR8316902	Silver flowering stage	84.748
	SRR8316904	Silver flowering stage	112.416
	SRR8316905	Silver flowering stage	66.061
	SRR8316906	Gold flowering stage	79.216
	SRR8316907	Gold flowering stage	93.441
	SRR8316908	Gold flowering stage	98.388
SRP132670	SRR6706286	Control	90.317
	SRR6706287	Light intensity 50%	78.413
	SRR6706288	Light intensity 20%	72.095
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	44.419
	CNS0095593	Slightly white alabastrum(diploid) 2	27.167
	CNS0095594	Slightly white alabastrum(diploid) 3	29.762
	CNS0095595	Whole white alabastrum(diploid) 2	32.676
	CNS0095596	Whole white alabastrum(diploid) 3	31.184
	CNS0095597	Whole white alabastrum(diploid) 4	23.740
	CNS0095598	Silvery flower (diploied) 1	84.726
	CNS0095599	Silvery flower (diploied) 2	101.973
	CNS0095600	Silvery flower (diploied) 3	168.631
	CNS0095601	Golden flower (diploid) 1	85.570
	CNS0095602	Golden flower (diploid) 2	114.564
	CNS0095603	Golden flower (diploid) 3	103.857
	CNS0095604	Slightly white alabastrum(tetraploid) 1	39.067
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.196
	CNS0095606	Slightly white alabastrum(tetraploid) 3	64.979
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.884
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.185
	CNS0095609	Whole white alabastrum(tetraploid) 3	47.698
	CNS0095610	Silvery flower (tetraploid) 1	169.957
	CNS0095611	Silvery flower (tetraploid) 2	196.924
	CNS0095612	Silvery flower (tetraploid) 3	359.027
	CNS0095613	Golden flower (tetraploid) 1	82.656
	CNS0095614	Golden flower (tetraploid) 2	83.055
	CNS0095615	Golden flower (tetraploid) 3	60.366
CRA001975	CRR073297	Stem 1	196.391
	CRR073298	Stem 2	177.641
	CRR073299	Stem 3	326.537
	CRR073300	Leaf 1	72.554
	CRR073301	Leaf 2	97.584
	CRR073302	Leaf 3	117.709
	CRR073303	Juvenile bud 1	147.331
	CRR073304	Juvenile bud 2	140.805
	CRR073305	Juvenile bud 3	139.023
	CRR073306	Third green 1	670.263
	CRR073307	Third green 2	575.404
	CRR073308	Third green 3	485.323
	CRR073309	Second white 1	872.721
	CRR073310	Second white 2	468.686
	CRR073311	Second white 3	375.321
	CRR073312	Silver flowering 1	379.740
	CRR073313	Silver flowering 2	482.844
	CRR073314	Silver flowering 3	291.674
	CRR073315	Gold flowering 1	2470.403
	CRR073316	Gold flowering 2	2157.046
	CRR073317	Gold flowering 3	3014.299
	CRR073318	Tawny withering 1	162.487
	CRR073319	Tawny withering 2	162.314
	CRR073320	Tawny withering 3	144.303