Gene detail

Detail information of GWHGAAZE014342

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHJ08575.1	2.6624E-92	DREB6-like protein [Cichorium intybus]
Swissprot	tr\|Q8H1E4\|RAP24_ARATH	1E-75	Ethylene-responsive transcription factor RAP2-4
trEMBL	tr\|A0A023JIR1\|A0A023JIR1_CICIN	1E-92	DREB6-like protein {ECO:0000313\|EMBL:AHJ08575.1}
TAIR10	AT1G78080.1	8E-49	related to AP2 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	10600892	10601479	-
GWHAAZE00000004	mRNA	10600892	10601479	-
GWHAAZE00000004	exon	10601092	10601479	-
GWHAAZE00000004	exon	10600892	10601061	-
GWHAAZE00000004	CDS	10601092	10601479	-
GWHAAZE00000004	CDS	10600892	10601061	-

Transcript Sequence
>GWHTAAZE014356 ATGAAGCAAGTGGGCTCACCACCCAAGCCCACCAAGCTCTACAGAGGGGTGAGGCAAAGGCACTGGGGAAAATGGGTCGCTGAGATCCGTTTACCCAAGAACCGTACCCGACTCTGGCTCGGCACATTCGATACGGCCGAAGAGGCAGCGCTGGCTTATGATAAAGCCGCCTACAAGCTGAGAGGAGATTCGGCTCGGCTCAATTTCCCACACCTGAGGCACGAGGGGTCCCACATAGGCGGAGAATTCGGCGAGTACAAGCCGCTTCACTCGGCTGTGGACGCTAAACTCAATGCTATCTGTCAGAACTTGGCGGAGGGTAAGAGTATTGATGTTAAAAAGCCGTCCTCGAAGAGATCCGTGGCGGCTGCTAAACCGACTCCAGCGGAGGGGGGGTGTGTGAAGGCGGAAGGGAGCTCCGAGAGTGACGGGTCTTCGTCGGATCTGACGTTCCCGGAGTTCAGGGAGGAGGAACCGGCTTGGGAAGTGTGTTCATCGGCTGAGAATTTTATGTTGGAGAAGTATCCATCTTATGAGATTGATTGGGGTTCTATATAG

Network for GWHGAAZE014342

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	14	62	2.80E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.072
	SRR3591706	second leaf	14.533
	SRR3591707	mature leaf	16.749
	SRR3591708	Shoot apex	30.680
	SRR3591709	Stem	48.612
	SRR3591710	White floral bud	64.152
	SRR3591711	White flower	59.918
	SRR3591712	Green floral bud	47.314
	SRR3591713	Yellow flower	20.572
SRP173429	SRR8316895	Juvenile bud stage	59.004
	SRR8316896	Juvenile bud stage	40.523
	SRR8316897	Juvenile bud stage	42.576
	SRR8316894	Third green stage	12.361
	SRR8316900	Third green stage	19.467
	SRR8316901	Third green stage	37.968
	SRR8316898	Complete white stage	13.816
	SRR8316899	Complete white stage	103.099
	SRR8316903	Complete white stage	18.730
	SRR8316902	Silver flowering stage	12.505
	SRR8316904	Silver flowering stage	11.486
	SRR8316905	Silver flowering stage	10.240
	SRR8316906	Gold flowering stage	15.637
	SRR8316907	Gold flowering stage	17.016
	SRR8316908	Gold flowering stage	15.325
SRP132670	SRR6706286	Control	16.009
	SRR6706287	Light intensity 50%	18.741
	SRR6706288	Light intensity 20%	16.983
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	85.129
	CNS0095593	Slightly white alabastrum(diploid) 2	93.921
	CNS0095594	Slightly white alabastrum(diploid) 3	104.777
	CNS0095595	Whole white alabastrum(diploid) 2	85.338
	CNS0095596	Whole white alabastrum(diploid) 3	13.411
	CNS0095597	Whole white alabastrum(diploid) 4	53.811
	CNS0095598	Silvery flower (diploied) 1	125.158
	CNS0095599	Silvery flower (diploied) 2	141.451
	CNS0095600	Silvery flower (diploied) 3	43.248
	CNS0095601	Golden flower (diploid) 1	135.376
	CNS0095602	Golden flower (diploid) 2	88.309
	CNS0095603	Golden flower (diploid) 3	79.755
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.404
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.357
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.298
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.496
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.168
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.211
	CNS0095610	Silvery flower (tetraploid) 1	9.889
	CNS0095611	Silvery flower (tetraploid) 2	7.546
	CNS0095612	Silvery flower (tetraploid) 3	31.037
	CNS0095613	Golden flower (tetraploid) 1	5.784
	CNS0095614	Golden flower (tetraploid) 2	7.161
	CNS0095615	Golden flower (tetraploid) 3	2.716
CRA001975	CRR073297	Stem 1	70.230
	CRR073298	Stem 2	76.210
	CRR073299	Stem 3	44.426
	CRR073300	Leaf 1	110.935
	CRR073301	Leaf 2	144.975
	CRR073302	Leaf 3	41.505
	CRR073303	Juvenile bud 1	61.111
	CRR073304	Juvenile bud 2	42.583
	CRR073305	Juvenile bud 3	79.093
	CRR073306	Third green 1	49.601
	CRR073307	Third green 2	63.236
	CRR073308	Third green 3	47.707
	CRR073309	Second white 1	20.648
	CRR073310	Second white 2	37.214
	CRR073311	Second white 3	15.991
	CRR073312	Silver flowering 1	33.786
	CRR073313	Silver flowering 2	35.010
	CRR073314	Silver flowering 3	25.249
	CRR073315	Gold flowering 1	56.034
	CRR073316	Gold flowering 2	107.383
	CRR073317	Gold flowering 3	37.709
	CRR073318	Tawny withering 1	67.603
	CRR073319	Tawny withering 2	240.292
	CRR073320	Tawny withering 3	80.419