Gene detail

Detail information of GWHGAAZE014262

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADK93079.1	1.2009E-127	14-3-3f protein [Gossypium hirsutum]
Swissprot	tr\|P93207\|14310_SOLLC	6E-125	14-3-3 protein 10
trEMBL	tr\|D9Z6D3\|D9Z6D3_GOSHI	4E-128	14-3-3f protein {ECO:0000313\|EMBL:ADK93079.1}
TAIR10	AT5G65430.1	3E-96	general regulatory factor 8

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	9028432	9032381	+
GWHAAZE00000004	mRNA	9028432	9032381	+
GWHAAZE00000004	exon	9028432	9028929	+
GWHAAZE00000004	exon	9032102	9032218	+
GWHAAZE00000004	exon	9032361	9032381	+
GWHAAZE00000004	CDS	9028432	9028929	+
GWHAAZE00000004	CDS	9032102	9032218	+
GWHAAZE00000004	CDS	9032361	9032381	+

Transcript Sequence
>GWHTAAZE014276 ATGGCGAACTCAGTACCGGACAATCTTTCCAGAGAGCAGTACGTATACATGGCGAAACTCGCCGAGCAAGCCGAGCGGTACGAAGAGATGGTCCAATTCATGGAGAAGCTCGTGGCCGGATCTACTCCGGCGGCGGAGCTCACCGTCGAAGAGCGTAACCTTCTCTCCGTCGCCTACAAGAACGTCATCGGCTCTCTCCGAGCCGCATGGAGGATCATCTCTTCGATCGAGCAAAAAGAGGAGTCTCGCAAGAACGAGGACCACGTTGTGCTTGTTAAGGACTACAGATCTAAAGTTGAGGCTGAGCTTTCGGATGTTTGTGCTGGTATTCTAAAGCTTTTGGACTCGAATCTGGTGCCTTCGGCTTCAACGAGCGAGTCAAAGGTGTTTTATTTGAAGATGAAGGGCGATTACTATAGGTATCTTGCCGAGTTCAAGGTCGGCGATGAACGTAAGGAGGCGGCTGAGGCTACTATGACCTCTTACAAGGCTGCTCAGGCATTTGAGGAAGCCATAGCGGAGCTGGACACTCTGGGTGAAGAATCATACAAGGACAGCACTCTGATCATGCAACTCCTGAGGGACAATCTCACGCTATGGACATCTGATGTGCAGGATCAGTTGGACGAGCCTTGA

Network for GWHGAAZE014262

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00244.21	2014/3/3	17	166	3.30E-56
PF00244.21	2014/3/3	164	201	4.80E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06630	YWHAE	MAPK signaling pathway - yeast	map04011
		Hippo signaling pathway	map04390
		Hippo signaling pathway - fly	map04391
		PI3K-Akt signaling pathway	map04151
		Cell cycle	map04110
		Oocyte meiosis	map04114
		NOD-like receptor signaling pathway	map04621
		Neurotrophin signaling pathway	map04722

Gene Ontology

GO term	Ontology	Name
GO:0019904	molecular_function	protein domain specific binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	222.015
	SRR3591706	second leaf	147.829
	SRR3591707	mature leaf	128.986
	SRR3591708	Shoot apex	222.685
	SRR3591709	Stem	196.773
	SRR3591710	White floral bud	161.591
	SRR3591711	White flower	205.076
	SRR3591712	Green floral bud	192.285
	SRR3591713	Yellow flower	189.364
SRP173429	SRR8316895	Juvenile bud stage	97.505
	SRR8316896	Juvenile bud stage	131.289
	SRR8316897	Juvenile bud stage	71.386
	SRR8316894	Third green stage	63.650
	SRR8316900	Third green stage	172.035
	SRR8316901	Third green stage	168.438
	SRR8316898	Complete white stage	99.139
	SRR8316899	Complete white stage	315.507
	SRR8316903	Complete white stage	145.794
	SRR8316902	Silver flowering stage	56.444
	SRR8316904	Silver flowering stage	80.797
	SRR8316905	Silver flowering stage	46.072
	SRR8316906	Gold flowering stage	158.030
	SRR8316907	Gold flowering stage	146.447
	SRR8316908	Gold flowering stage	158.782
SRP132670	SRR6706286	Control	319.152
	SRR6706287	Light intensity 50%	281.865
	SRR6706288	Light intensity 20%	299.449
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	125.770
	CNS0095593	Slightly white alabastrum(diploid) 2	147.065
	CNS0095594	Slightly white alabastrum(diploid) 3	101.181
	CNS0095595	Whole white alabastrum(diploid) 2	117.924
	CNS0095596	Whole white alabastrum(diploid) 3	109.882
	CNS0095597	Whole white alabastrum(diploid) 4	115.774
	CNS0095598	Silvery flower (diploied) 1	145.012
	CNS0095599	Silvery flower (diploied) 2	133.474
	CNS0095600	Silvery flower (diploied) 3	237.963
	CNS0095601	Golden flower (diploid) 1	138.961
	CNS0095602	Golden flower (diploid) 2	232.024
	CNS0095603	Golden flower (diploid) 3	233.175
	CNS0095604	Slightly white alabastrum(tetraploid) 1	160.605
	CNS0095605	Slightly white alabastrum(tetraploid) 2	134.661
	CNS0095606	Slightly white alabastrum(tetraploid) 3	255.827
	CNS0095607	Whole white alabastrum(tetraploid) 1	95.755
	CNS0095608	Whole white alabastrum(tetraploid) 2	76.426
	CNS0095609	Whole white alabastrum(tetraploid) 3	167.161
	CNS0095610	Silvery flower (tetraploid) 1	226.258
	CNS0095611	Silvery flower (tetraploid) 2	299.665
	CNS0095612	Silvery flower (tetraploid) 3	246.436
	CNS0095613	Golden flower (tetraploid) 1	171.514
	CNS0095614	Golden flower (tetraploid) 2	217.840
	CNS0095615	Golden flower (tetraploid) 3	292.644
CRA001975	CRR073297	Stem 1	218.478
	CRR073298	Stem 2	217.254
	CRR073299	Stem 3	279.250
	CRR073300	Leaf 1	249.343
	CRR073301	Leaf 2	271.391
	CRR073302	Leaf 3	318.682
	CRR073303	Juvenile bud 1	315.637
	CRR073304	Juvenile bud 2	287.500
	CRR073305	Juvenile bud 3	312.475
	CRR073306	Third green 1	143.406
	CRR073307	Third green 2	167.953
	CRR073308	Third green 3	148.897
	CRR073309	Second white 1	209.087
	CRR073310	Second white 2	145.873
	CRR073311	Second white 3	95.715
	CRR073312	Silver flowering 1	90.933
	CRR073313	Silver flowering 2	109.475
	CRR073314	Silver flowering 3	79.710
	CRR073315	Gold flowering 1	232.804
	CRR073316	Gold flowering 2	238.476
	CRR073317	Gold flowering 3	296.315
	CRR073318	Tawny withering 1	348.676
	CRR073319	Tawny withering 2	266.683
	CRR073320	Tawny withering 3	329.414