Gene detail

Detail information of GWHGAAZE014189

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011074583.1	5.04841E-42	PREDICTED: basic leucine zipper 43-like [Sesamum indicum]
Swissprot	tr\|Q9FMC2\|BZP43_ARATH	8E-11	Basic leucine zipper 43
trEMBL	tr\|A0A068U073\|A0A068U073_COFCA	2E-38	Coffea canephora DH200=94 genomic scaffold, scaffold_6 {ECO:0000313\|EMBL:CDP01018.1}
TAIR10	AT5G15830.1	6E-10	basic leucine-zipper 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	7478469	7478885	+
GWHAAZE00000004	mRNA	7478469	7478885	+
GWHAAZE00000004	exon	7478469	7478885	+
GWHAAZE00000004	CDS	7478469	7478885	+

Transcript Sequence
>GWHTAAZE014203 ATGATGTTCTCCGAAGAACCGGTCCAATTCCAATTTACATCTAACGAAATAAGCGAACTCTTGTCCTTCTTCGAATCAGAAGTCCCGGTCAATTCAACATCCGGTTCAGAAACAACCCGGTCGGTTTATTCCCAAGAAGAGCGGAAGCGCAGGCGGATGATATCAAACCGGGAATCAGCCCGGCGGTCCAGGCAGAGAAAGAAGAGTCATTTAGAGAACCTGACAACACAACTGAATCGGCTGAGAACGGAGAACCGGGAACTAAGGAACCGGTTATGCTTAATTGCACAACAGAACCATCTAGTTGAAAGAGAGACACAAGAGCTGGGGTTTGAAGCCATGGACCTACAAACAAAATTGTCGGGTTTATACCAAATCTTGGTCAACATGCAGTTTTCCAACACTTATTCTCATTAG

Network for GWHGAAZE014189

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0100	Transcription factor bZIP family Transcription factor bZIP GO:0003700 DNA-binding transcription factor activity GOslim:molecular_function

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	46	96	2.40E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.249
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.968
	SRR3591709	Stem	2.491
	SRR3591710	White floral bud	92.633
	SRR3591711	White flower	6.851
	SRR3591712	Green floral bud	3.840
	SRR3591713	Yellow flower	0.258
SRP173429	SRR8316895	Juvenile bud stage	0.323
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.163
	SRR8316900	Third green stage	4.080
	SRR8316901	Third green stage	5.091
	SRR8316898	Complete white stage	108.063
	SRR8316899	Complete white stage	24.853
	SRR8316903	Complete white stage	195.220
	SRR8316902	Silver flowering stage	18.455
	SRR8316904	Silver flowering stage	21.005
	SRR8316905	Silver flowering stage	0.287
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	1.661
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	5.827
	SRR6706287	Light intensity 50%	9.307
	SRR6706288	Light intensity 20%	4.419
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.152
	CNS0095593	Slightly white alabastrum(diploid) 2	1.137
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.021
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.927
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	3.597
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.598
	CNS0095603	Golden flower (diploid) 3	0.210
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.138
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.412
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.694
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.247
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.160
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.173
	CNS0095610	Silvery flower (tetraploid) 1	2.493
	CNS0095611	Silvery flower (tetraploid) 2	0.079
	CNS0095612	Silvery flower (tetraploid) 3	0.857
	CNS0095613	Golden flower (tetraploid) 1	0.085
	CNS0095614	Golden flower (tetraploid) 2	0.170
	CNS0095615	Golden flower (tetraploid) 3	0.030
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.762
	CRR073299	Stem 3	0.101
	CRR073300	Leaf 1	13.738
	CRR073301	Leaf 2	10.431
	CRR073302	Leaf 3	6.506
	CRR073303	Juvenile bud 1	13.541
	CRR073304	Juvenile bud 2	38.976
	CRR073305	Juvenile bud 3	20.091
	CRR073306	Third green 1	4.803
	CRR073307	Third green 2	54.554
	CRR073308	Third green 3	51.416
	CRR073309	Second white 1	0.282
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.202
	CRR073312	Silver flowering 1	0.747
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.126
	CRR073317	Gold flowering 3	0.973
	CRR073318	Tawny withering 1	1.707
	CRR073319	Tawny withering 2	0.702
	CRR073320	Tawny withering 3	0.157