Gene detail

Detail information of GWHGAAZE014175

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010274399.1	1.45025E-69	PREDICTED: NADH dehydrogenase [ubiquinone] iron-sulfur protein 4, mitochondrial-like isoform X2 [Nelumbo nucifera]
Swissprot	tr\|Q9FJW4\|NDUS4_ARATH	2E-55	NADH dehydrogenase [ubiquinone] iron-sulfur protein 4, mitochondrial (Precursor)
trEMBL	tr\|A0A067LBX8\|A0A067LBX8_JATCU	3E-69	Uncharacterized protein {ECO:0000313\|EMBL:KDP41609.1}
TAIR10	AT5G67590.1	2E-44	NADH-ubiquinone oxidoreductase-related

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	7175532	7177923	+
GWHAAZE00000004	mRNA	7175532	7177923	+
GWHAAZE00000004	exon	7175532	7175693	+
GWHAAZE00000004	exon	7176363	7176451	+
GWHAAZE00000004	exon	7177315	7177476	+
GWHAAZE00000004	exon	7177863	7177923	+
GWHAAZE00000004	CDS	7175532	7175693	+
GWHAAZE00000004	CDS	7176363	7176451	+
GWHAAZE00000004	CDS	7177315	7177476	+
GWHAAZE00000004	CDS	7177863	7177923	+

Transcript Sequence
>GWHTAAZE014189 ATGGCGAACTCTCTTCGACGTGGACTAGCTGTGGCTCGCTCTCATGGATCCTCTTCTGCTTTTTACTCGGCCAGATTGTTTTCATCAGATGCCTTGGTTGAAACCAGACCTGGTGAAGTCGGAATTGTTTCCGGTATCCCCGAAGAACACCTTCGCCGGAGGGTTGTGATTTACTCTCCTGCTCGCACTGCGTCTCAACAAGGCTCAGGCAAAGTTGGGAAGTGGAAAATCAACTTTTTATCTACTCAAAAGTGGGAAAATCCATTGATGGGCTGGACATCCACAGGAGACCCATATGCTAATGTTGGTGATGCAGGACTAAGTTTTGATAGTGAAGAAGCGGCAAAAGCATTTGCTGAGAAGTATGGTTGGGAGTATGTGGTATGTTCTTCAGCTTATGTAATTTTGTGCGATCACGTTGAAGAGGAATGTGCTTTGAAGGGCACGATATTGATGCCTGAAATGGTTGTGTGA

Network for GWHGAAZE014175

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04800.13	ETC_C1_NDUFA4	54	130	2.40E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03937	NDUFS4	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0022900	biological_process	electron transport chain
GO:0016651	molecular_function	oxidoreductase activity, acting on NAD(P)H

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.371
	SRR3591706	second leaf	20.574
	SRR3591707	mature leaf	30.424
	SRR3591708	Shoot apex	27.547
	SRR3591709	Stem	64.433
	SRR3591710	White floral bud	60.640
	SRR3591711	White flower	84.984
	SRR3591712	Green floral bud	68.224
	SRR3591713	Yellow flower	121.752
SRP173429	SRR8316895	Juvenile bud stage	28.515
	SRR8316896	Juvenile bud stage	52.959
	SRR8316897	Juvenile bud stage	31.232
	SRR8316894	Third green stage	13.173
	SRR8316900	Third green stage	69.860
	SRR8316901	Third green stage	54.115
	SRR8316898	Complete white stage	24.161
	SRR8316899	Complete white stage	45.273
	SRR8316903	Complete white stage	39.755
	SRR8316902	Silver flowering stage	22.757
	SRR8316904	Silver flowering stage	24.169
	SRR8316905	Silver flowering stage	17.357
	SRR8316906	Gold flowering stage	52.311
	SRR8316907	Gold flowering stage	59.035
	SRR8316908	Gold flowering stage	52.488
SRP132670	SRR6706286	Control	158.329
	SRR6706287	Light intensity 50%	137.772
	SRR6706288	Light intensity 20%	140.299
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	93.231
	CNS0095593	Slightly white alabastrum(diploid) 2	83.009
	CNS0095594	Slightly white alabastrum(diploid) 3	97.301
	CNS0095595	Whole white alabastrum(diploid) 2	98.884
	CNS0095596	Whole white alabastrum(diploid) 3	94.892
	CNS0095597	Whole white alabastrum(diploid) 4	89.793
	CNS0095598	Silvery flower (diploied) 1	87.629
	CNS0095599	Silvery flower (diploied) 2	90.066
	CNS0095600	Silvery flower (diploied) 3	94.975
	CNS0095601	Golden flower (diploid) 1	88.659
	CNS0095602	Golden flower (diploid) 2	89.966
	CNS0095603	Golden flower (diploid) 3	96.735
	CNS0095604	Slightly white alabastrum(tetraploid) 1	159.216
	CNS0095605	Slightly white alabastrum(tetraploid) 2	158.890
	CNS0095606	Slightly white alabastrum(tetraploid) 3	124.836
	CNS0095607	Whole white alabastrum(tetraploid) 1	158.456
	CNS0095608	Whole white alabastrum(tetraploid) 2	167.723
	CNS0095609	Whole white alabastrum(tetraploid) 3	191.407
	CNS0095610	Silvery flower (tetraploid) 1	176.250
	CNS0095611	Silvery flower (tetraploid) 2	178.549
	CNS0095612	Silvery flower (tetraploid) 3	167.260
	CNS0095613	Golden flower (tetraploid) 1	141.754
	CNS0095614	Golden flower (tetraploid) 2	189.866
	CNS0095615	Golden flower (tetraploid) 3	51.228
CRA001975	CRR073297	Stem 1	76.502
	CRR073298	Stem 2	75.948
	CRR073299	Stem 3	83.154
	CRR073300	Leaf 1	99.013
	CRR073301	Leaf 2	114.627
	CRR073302	Leaf 3	118.416
	CRR073303	Juvenile bud 1	123.439
	CRR073304	Juvenile bud 2	117.400
	CRR073305	Juvenile bud 3	87.888
	CRR073306	Third green 1	90.233
	CRR073307	Third green 2	78.920
	CRR073308	Third green 3	79.327
	CRR073309	Second white 1	62.959
	CRR073310	Second white 2	55.270
	CRR073311	Second white 3	40.628
	CRR073312	Silver flowering 1	45.166
	CRR073313	Silver flowering 2	58.347
	CRR073314	Silver flowering 3	42.484
	CRR073315	Gold flowering 1	46.346
	CRR073316	Gold flowering 2	42.278
	CRR073317	Gold flowering 3	39.927
	CRR073318	Tawny withering 1	77.452
	CRR073319	Tawny withering 2	77.260
	CRR073320	Tawny withering 3	50.971