Gene detail

Detail information of GWHGAAZE014158

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006363932.1	2.729E-107	PREDICTED: PXMP2/4 family protein 3-like [Solanum tuberosum]
Swissprot	tr\|Q9ZS51\|PMP22_ARATH	3E-16	Peroxisomal membrane protein PMP22
trEMBL	tr\|K4BUP1\|K4BUP1_SOLLC	1E-106	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc04g078040.2.1}
TAIR10	AT5G43140.1	1E-67	Peroxisomal membrane 22 kDa (Mpv17/PMP22) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	6899486	6901973	+
GWHAAZE00000004	mRNA	6899486	6901973	+
GWHAAZE00000004	exon	6899486	6899872	+
GWHAAZE00000004	exon	6900622	6900850	+
GWHAAZE00000004	exon	6901684	6901808	+
GWHAAZE00000004	exon	6901890	6901973	+
GWHAAZE00000004	five_prime_UTR	6899486	6899518	+
GWHAAZE00000004	CDS	6899519	6899872	+
GWHAAZE00000004	CDS	6900622	6900850	+
GWHAAZE00000004	CDS	6901684	6901808	+
GWHAAZE00000004	CDS	6901890	6901973	+

Transcript Sequence
>GWHTAAZE014172 TCGCTTCTCCAAAATAGGGCAAATTCTCTGGAAATGGGAATCAATTGCTTAACAAATCTAACCAAACGCGGTCTCCTTCAACTGTCGGAGCAACGTTTCTTTCTCAATTCTGGTGTTTGTATTCGATCTCAATTCAACCAAAACAAACAACAACAATGCAGAGCTTACGCTCACAATTTCAGCAAGCTTAAGAATACCGATTCCCGCCGGCCATTCTATGTACCAAAAAATCCTCACCGTTGGTATTCATCTACGCCATCGTCGTCTTCTTCCAAGCAGAAAGTAGGGTTACTCGCTTGGTACTTGGGAATGCTGGAGTCGCGTCCTATTATTACTAAAAGTGTCTCATCCGGTATTATTTACGGAGTTGCCGACTTGACCTCTCAGGCGATTACAATGTCGCCTTCAGGCTCTTTTGACTTGATAAGGACATTACGTATGACTGGGTATGGGCTGCTATTTTTAGGGGCAGCACAGCATGTATGGTATAATTTTATTGGAAGAGTCCTACCAAAGCGAGATATAATCACTACTGTCAAGAAGCTTACCATAGGGCAGCTAACTTATGGACCTTTTGTTACTGCTGTTTTCTTCAGTTACAATGCAGGCCTGCAAGGTGAAAATGGTAATGAGATTGCTGCCAGGTTAAAGCGGGACCTGATCCCAACAATTGTAAATGGTCTTGTATACTGGCCGATTTGTGATTTCATCACTTTCAAAATCGTCCCGGTCCACTTACAGCCACTATCGAATAGTTCTTTCTCATACCTGTGGACCATTTATTTGACATACATGGGAAGCCTGAAGAAAGCAGTTGTCGAGTAG

Network for GWHGAAZE014158

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04117.13	Mpv17_PMP22	193	251	5.40E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13348	MPV17	Peroxisome	map04146

Gene Ontology

GO term	Ontology	Name
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.626
	SRR3591706	second leaf	10.388
	SRR3591707	mature leaf	5.817
	SRR3591708	Shoot apex	12.816
	SRR3591709	Stem	5.303
	SRR3591710	White floral bud	21.685
	SRR3591711	White flower	97.211
	SRR3591712	Green floral bud	31.050
	SRR3591713	Yellow flower	113.389
SRP173429	SRR8316895	Juvenile bud stage	7.974
	SRR8316896	Juvenile bud stage	9.313
	SRR8316897	Juvenile bud stage	5.615
	SRR8316894	Third green stage	5.047
	SRR8316900	Third green stage	25.706
	SRR8316901	Third green stage	22.055
	SRR8316898	Complete white stage	12.546
	SRR8316899	Complete white stage	25.895
	SRR8316903	Complete white stage	12.147
	SRR8316902	Silver flowering stage	10.246
	SRR8316904	Silver flowering stage	16.244
	SRR8316905	Silver flowering stage	7.546
	SRR8316906	Gold flowering stage	17.253
	SRR8316907	Gold flowering stage	20.151
	SRR8316908	Gold flowering stage	15.001
SRP132670	SRR6706286	Control	15.791
	SRR6706287	Light intensity 50%	19.072
	SRR6706288	Light intensity 20%	20.772
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.989
	CNS0095593	Slightly white alabastrum(diploid) 2	12.734
	CNS0095594	Slightly white alabastrum(diploid) 3	8.811
	CNS0095595	Whole white alabastrum(diploid) 2	18.062
	CNS0095596	Whole white alabastrum(diploid) 3	22.405
	CNS0095597	Whole white alabastrum(diploid) 4	26.520
	CNS0095598	Silvery flower (diploied) 1	7.484
	CNS0095599	Silvery flower (diploied) 2	8.480
	CNS0095600	Silvery flower (diploied) 3	17.309
	CNS0095601	Golden flower (diploid) 1	6.878
	CNS0095602	Golden flower (diploid) 2	15.989
	CNS0095603	Golden flower (diploid) 3	13.016
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.636
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.427
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.713
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.546
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.544
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.412
	CNS0095610	Silvery flower (tetraploid) 1	12.927
	CNS0095611	Silvery flower (tetraploid) 2	15.785
	CNS0095612	Silvery flower (tetraploid) 3	22.735
	CNS0095613	Golden flower (tetraploid) 1	8.923
	CNS0095614	Golden flower (tetraploid) 2	14.537
	CNS0095615	Golden flower (tetraploid) 3	11.684
CRA001975	CRR073297	Stem 1	6.235
	CRR073298	Stem 2	6.283
	CRR073299	Stem 3	6.085
	CRR073300	Leaf 1	12.270
	CRR073301	Leaf 2	9.062
	CRR073302	Leaf 3	10.018
	CRR073303	Juvenile bud 1	13.403
	CRR073304	Juvenile bud 2	18.797
	CRR073305	Juvenile bud 3	8.953
	CRR073306	Third green 1	15.713
	CRR073307	Third green 2	8.375
	CRR073308	Third green 3	11.629
	CRR073309	Second white 1	11.322
	CRR073310	Second white 2	12.861
	CRR073311	Second white 3	8.324
	CRR073312	Silver flowering 1	13.846
	CRR073313	Silver flowering 2	8.659
	CRR073314	Silver flowering 3	8.032
	CRR073315	Gold flowering 1	6.203
	CRR073316	Gold flowering 2	7.803
	CRR073317	Gold flowering 3	3.279
	CRR073318	Tawny withering 1	2.534
	CRR073319	Tawny withering 2	3.559
	CRR073320	Tawny withering 3	5.766