Gene detail

Detail information of GWHGAAZE014033

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010278487.1	2.56043E-96	PREDICTED: 30S ribosomal protein S9, chloroplastic-like [Nelumbo nucifera]
Swissprot	tr\|P82278\|RR9_SPIOL	1E-96	30S ribosomal protein S9, chloroplastic (Precursor; Fragment)
trEMBL	tr\|C6SXF0\|C6SXF0_SOYBN	1E-93	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA17G36580.1}
TAIR10	AT1G74970.1	2E-65	ribosomal protein S9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	4686353	4689277	+
GWHAAZE00000004	mRNA	4686353	4689277	+
GWHAAZE00000004	exon	4686353	4686583	+
GWHAAZE00000004	exon	4688990	4689277	+
GWHAAZE00000004	CDS	4686353	4686583	+
GWHAAZE00000004	CDS	4688990	4689277	+

Transcript Sequence
>GWHTAAZE014047 CCTGTTTCCGTATCTCACGTACCCAAAAGGCCTCTTGTCATCTCCGCCGTCGCTGCCACGTCGCCGGTCGATTTGGAAACTTCAGATCTCAAGGCCTACGTGAAATCGAGGCTTCCCGGCGGGATAGCTGCTCAGAGATTAATCGGAACCGGTCGTCGGAAATGTGCCATTGCTAGAGTTGTTCTCCAGGAAGGAACTGGAAAATTCTTCATCAATTATCGCGACGCCAAGGAATATCTTCAAGGGAATCCATTATGGCTTCAGTACATCAAAGTCCCTTTGGTGACTTTAGGATATGGAACCGATTATGATGTATTCGTGAAGGTGCATGGTGGGGGACTTTCTGGGCAGGCTCAGGCAATCACACTGGGTGTTGCACGGGCGTTGCTAAAAGTGAGTGAAAGCCATAGAGTGCCTCTCAGACAGGAAGGTCTTCTTACTCGGGATGCTAGAGTTGTTGAGAGGAAGAAAGCTGGTCTCAAGAAAGCTCGAAAGGCCCCTCAATTCTCCAAGCGTTGA

Network for GWHGAAZE014033

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00380.20	Ribosomal_S9	51	172	3.80E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02996	RP-S9, MRPS9, rpsI	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	123.561
	SRR3591706	second leaf	281.078
	SRR3591707	mature leaf	218.744
	SRR3591708	Shoot apex	212.723
	SRR3591709	Stem	47.179
	SRR3591710	White floral bud	67.051
	SRR3591711	White flower	85.653
	SRR3591712	Green floral bud	124.921
	SRR3591713	Yellow flower	71.621
SRP173429	SRR8316895	Juvenile bud stage	64.267
	SRR8316896	Juvenile bud stage	74.315
	SRR8316897	Juvenile bud stage	51.537
	SRR8316894	Third green stage	38.858
	SRR8316900	Third green stage	138.680
	SRR8316901	Third green stage	122.222
	SRR8316898	Complete white stage	44.216
	SRR8316899	Complete white stage	117.836
	SRR8316903	Complete white stage	59.666
	SRR8316902	Silver flowering stage	42.126
	SRR8316904	Silver flowering stage	49.086
	SRR8316905	Silver flowering stage	28.200
	SRR8316906	Gold flowering stage	88.565
	SRR8316907	Gold flowering stage	99.275
	SRR8316908	Gold flowering stage	91.121
SRP132670	SRR6706286	Control	120.163
	SRR6706287	Light intensity 50%	112.579
	SRR6706288	Light intensity 20%	129.544
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	56.123
	CNS0095593	Slightly white alabastrum(diploid) 2	60.531
	CNS0095594	Slightly white alabastrum(diploid) 3	39.580
	CNS0095595	Whole white alabastrum(diploid) 2	60.349
	CNS0095596	Whole white alabastrum(diploid) 3	75.319
	CNS0095597	Whole white alabastrum(diploid) 4	51.784
	CNS0095598	Silvery flower (diploied) 1	62.362
	CNS0095599	Silvery flower (diploied) 2	62.858
	CNS0095600	Silvery flower (diploied) 3	85.340
	CNS0095601	Golden flower (diploid) 1	57.702
	CNS0095602	Golden flower (diploid) 2	73.239
	CNS0095603	Golden flower (diploid) 3	70.760
	CNS0095604	Slightly white alabastrum(tetraploid) 1	61.386
	CNS0095605	Slightly white alabastrum(tetraploid) 2	63.429
	CNS0095606	Slightly white alabastrum(tetraploid) 3	82.896
	CNS0095607	Whole white alabastrum(tetraploid) 1	30.881
	CNS0095608	Whole white alabastrum(tetraploid) 2	45.910
	CNS0095609	Whole white alabastrum(tetraploid) 3	106.864
	CNS0095610	Silvery flower (tetraploid) 1	91.707
	CNS0095611	Silvery flower (tetraploid) 2	123.010
	CNS0095612	Silvery flower (tetraploid) 3	99.704
	CNS0095613	Golden flower (tetraploid) 1	73.037
	CNS0095614	Golden flower (tetraploid) 2	85.602
	CNS0095615	Golden flower (tetraploid) 3	79.707
CRA001975	CRR073297	Stem 1	144.686
	CRR073298	Stem 2	129.667
	CRR073299	Stem 3	180.074
	CRR073300	Leaf 1	137.960
	CRR073301	Leaf 2	148.078
	CRR073302	Leaf 3	201.772
	CRR073303	Juvenile bud 1	184.615
	CRR073304	Juvenile bud 2	184.497
	CRR073305	Juvenile bud 3	121.404
	CRR073306	Third green 1	96.053
	CRR073307	Third green 2	68.820
	CRR073308	Third green 3	64.472
	CRR073309	Second white 1	123.832
	CRR073310	Second white 2	77.898
	CRR073311	Second white 3	71.910
	CRR073312	Silver flowering 1	69.541
	CRR073313	Silver flowering 2	77.792
	CRR073314	Silver flowering 3	67.049
	CRR073315	Gold flowering 1	354.865
	CRR073316	Gold flowering 2	341.308
	CRR073317	Gold flowering 3	319.810
	CRR073318	Tawny withering 1	88.109
	CRR073319	Tawny withering 2	66.280
	CRR073320	Tawny withering 3	87.219