Gene detail

Detail information of GWHGAAZE013986

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009348261.1	3.7589E-125	PREDICTED: NADH--cytochrome b5 reductase 1 [Pyrus x bretschneideri]
Swissprot	tr\|Q9ZNT1\|NB5R1_ARATH	2E-117	NADH--cytochrome b5 reductase 1
trEMBL	tr\|B9SY78\|B9SY78_RICCO	1E-124	NADH-cytochrome B5 reductase, putative {ECO:0000313\|EMBL:EEF31419.1}
TAIR10	AT5G17770.1	9E-94	NADH:cytochrome B5 reductase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	3990167	3991153	-
GWHAAZE00000004	mRNA	3990167	3991153	-
GWHAAZE00000004	exon	3990167	3990739	-
GWHAAZE00000004	exon	3991121	3991153	-
GWHAAZE00000004	CDS	3991121	3991153	-
GWHAAZE00000004	CDS	3990167	3990739	-

Transcript Sequence
>GWHTAAZE014000 ATGGATTCATTGACGGTGATGGCTGTGAAAAAGAAACCCAAAAGGTGTTTGGATCCCGAGAATTTCAAGGATTTCAAGCTTGTGAAGCGCACGCAGATTAGCCATAATGTGGCTAAGTTCAGATTTGAACTTCCAACACCTACTTCAGTGTTGGGCCTTCCAATCGATCAACACATAAGTTGCAGAGGAAAAGATAGCCAAGGTGAGGAGGTTATTAAACCGTACACCCCAACGACTTTGGACTCTGATGTTAGATACTTCGAGTTAGTTATAAAGATGTATCCGCAAAGAAGGATGTCTCACCATTTTCGAGAGATGCGTGTTGGTGATTACATGGCCGTAAAGGGACCCAAGGGCCGCTTCAAGTATCAACCAGGCCAAGTGAGAGCTTTCGGAATGCTTGCTGGGGGTTCTGGTATTACCCCAATGTTCAAGGTTGCTCGAGCTATACTCGAAAACCCGAAAGACAACACCAAGGTGTATCTCATTTATGCTAATGTTACGTACGAGGACATCCTTTTAAAGGAAGAACTGGATAGCCTTGCTACCAATTATAGTGATCGCTTCAAAATCTTCTACGTTCTGAATCATCCACCGGAAGTATAG

Network for GWHGAAZE013986

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00970.25	FAD_binding_6	25	123	9.20E-29
PF00175.22	NAD_binding_1	133	198	8.60E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00326	E1.6.2.2	Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	30.938
	SRR3591706	second leaf	25.196
	SRR3591707	mature leaf	12.321
	SRR3591708	Shoot apex	32.209
	SRR3591709	Stem	51.211
	SRR3591710	White floral bud	12.010
	SRR3591711	White flower	8.592
	SRR3591712	Green floral bud	15.263
	SRR3591713	Yellow flower	4.296
SRP173429	SRR8316895	Juvenile bud stage	2.764
	SRR8316896	Juvenile bud stage	2.445
	SRR8316897	Juvenile bud stage	2.428
	SRR8316894	Third green stage	1.080
	SRR8316900	Third green stage	2.239
	SRR8316901	Third green stage	2.978
	SRR8316898	Complete white stage	1.188
	SRR8316899	Complete white stage	2.943
	SRR8316903	Complete white stage	1.501
	SRR8316902	Silver flowering stage	0.672
	SRR8316904	Silver flowering stage	0.685
	SRR8316905	Silver flowering stage	0.230
	SRR8316906	Gold flowering stage	0.685
	SRR8316907	Gold flowering stage	1.255
	SRR8316908	Gold flowering stage	3.163
SRP132670	SRR6706286	Control	1.842
	SRR6706287	Light intensity 50%	2.369
	SRR6706288	Light intensity 20%	2.888
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.216
	CNS0095593	Slightly white alabastrum(diploid) 2	2.317
	CNS0095594	Slightly white alabastrum(diploid) 3	2.808
	CNS0095595	Whole white alabastrum(diploid) 2	2.973
	CNS0095596	Whole white alabastrum(diploid) 3	0.917
	CNS0095597	Whole white alabastrum(diploid) 4	1.128
	CNS0095598	Silvery flower (diploied) 1	2.395
	CNS0095599	Silvery flower (diploied) 2	1.310
	CNS0095600	Silvery flower (diploied) 3	1.259
	CNS0095601	Golden flower (diploid) 1	0.798
	CNS0095602	Golden flower (diploid) 2	1.406
	CNS0095603	Golden flower (diploid) 3	0.838
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.206
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.580
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.401
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.205
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.713
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.407
	CNS0095610	Silvery flower (tetraploid) 1	2.370
	CNS0095611	Silvery flower (tetraploid) 2	1.234
	CNS0095612	Silvery flower (tetraploid) 3	0.951
	CNS0095613	Golden flower (tetraploid) 1	1.684
	CNS0095614	Golden flower (tetraploid) 2	3.935
	CNS0095615	Golden flower (tetraploid) 3	1.078
CRA001975	CRR073297	Stem 1	3.977
	CRR073298	Stem 2	3.542
	CRR073299	Stem 3	4.984
	CRR073300	Leaf 1	3.901
	CRR073301	Leaf 2	2.698
	CRR073302	Leaf 3	5.015
	CRR073303	Juvenile bud 1	3.900
	CRR073304	Juvenile bud 2	8.040
	CRR073305	Juvenile bud 3	4.207
	CRR073306	Third green 1	1.040
	CRR073307	Third green 2	1.428
	CRR073308	Third green 3	1.089
	CRR073309	Second white 1	0.453
	CRR073310	Second white 2	0.605
	CRR073311	Second white 3	0.446
	CRR073312	Silver flowering 1	2.448
	CRR073313	Silver flowering 2	1.137
	CRR073314	Silver flowering 3	1.349
	CRR073315	Gold flowering 1	2.088
	CRR073316	Gold flowering 2	1.873
	CRR073317	Gold flowering 3	2.240
	CRR073318	Tawny withering 1	4.232
	CRR073319	Tawny withering 2	3.920
	CRR073320	Tawny withering 3	6.059