Gene detail

Detail information of GWHGAAZE013955

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002306888.1	1.30521E-60	bZIP transcription factor family protein [Populus trichocarpa]
Swissprot	tr\|P24068\|OCS1_MAIZE	2E-24	Ocs element-binding factor 1
trEMBL	tr\|B9H4F3\|B9H4F3_POPTR	5E-61	BZIP transcription factor family protein {ECO:0000313\|EMBL:EEE93884.1}
TAIR10	AT1G75390.1	6E-34	basic leucine-zipper 44

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	3426136	3426630	-
GWHAAZE00000004	mRNA	3426136	3426630	-
GWHAAZE00000004	exon	3426136	3426630	-
GWHAAZE00000004	CDS	3426136	3426630	-

Transcript Sequence
>GWHTAAZE013969 ATGGCTTCTTCAAGTGGGAATTCATCAGGTTCAACCCAGATTCTTCAGAACTCTGGTTCAGAAGGGGATTTGCAGGTTATAATGGACCAAAGGAAGAGGAAGAGGATGCAATCGAATCGAGAATCGGCTAGGCGATCGAGGATGAGGAAACAGAAGCATCTTGATGATCTGATGGCTCAAGTTTCTCAGATCAAGAAAGAAAATAATCAGATCCACACAAGCACCACCATCACCACAGAGCACTACTTGAATATTGAGGCTGAGAATTCTGTTTTGAGGGCTCAGATGGATGAATTAAGCCAAAGGCTGCAGTCTCTTAATGATATCCTCAATTACATGAACATGATGAACACCACGACCAACAACAACAACAATGAAATCTATGATATAACAGAAGAGATAAATCAACAATCCATCATGGATCCGTGGAACTTGATGTACCTTAACCAACAACAACCCATCATGGCTTCTGCTGAAATGTTTCTTCAGTACTGA

Network for GWHGAAZE013955

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	31	74	1.00E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	39.003
	SRR3591706	second leaf	46.823
	SRR3591707	mature leaf	80.236
	SRR3591708	Shoot apex	44.868
	SRR3591709	Stem	101.343
	SRR3591710	White floral bud	42.335
	SRR3591711	White flower	39.483
	SRR3591712	Green floral bud	118.252
	SRR3591713	Yellow flower	29.561
SRP173429	SRR8316895	Juvenile bud stage	24.773
	SRR8316896	Juvenile bud stage	31.573
	SRR8316897	Juvenile bud stage	12.136
	SRR8316894	Third green stage	22.371
	SRR8316900	Third green stage	77.434
	SRR8316901	Third green stage	74.212
	SRR8316898	Complete white stage	12.087
	SRR8316899	Complete white stage	113.581
	SRR8316903	Complete white stage	18.284
	SRR8316902	Silver flowering stage	10.352
	SRR8316904	Silver flowering stage	8.917
	SRR8316905	Silver flowering stage	3.851
	SRR8316906	Gold flowering stage	24.875
	SRR8316907	Gold flowering stage	20.981
	SRR8316908	Gold flowering stage	26.316
SRP132670	SRR6706286	Control	9.388
	SRR6706287	Light intensity 50%	17.343
	SRR6706288	Light intensity 20%	18.672
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	51.607
	CNS0095593	Slightly white alabastrum(diploid) 2	65.575
	CNS0095594	Slightly white alabastrum(diploid) 3	47.422
	CNS0095595	Whole white alabastrum(diploid) 2	53.932
	CNS0095596	Whole white alabastrum(diploid) 3	51.707
	CNS0095597	Whole white alabastrum(diploid) 4	70.752
	CNS0095598	Silvery flower (diploied) 1	32.612
	CNS0095599	Silvery flower (diploied) 2	28.071
	CNS0095600	Silvery flower (diploied) 3	20.806
	CNS0095601	Golden flower (diploid) 1	35.400
	CNS0095602	Golden flower (diploid) 2	27.514
	CNS0095603	Golden flower (diploid) 3	27.513
	CNS0095604	Slightly white alabastrum(tetraploid) 1	52.649
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.512
	CNS0095606	Slightly white alabastrum(tetraploid) 3	97.497
	CNS0095607	Whole white alabastrum(tetraploid) 1	40.998
	CNS0095608	Whole white alabastrum(tetraploid) 2	39.655
	CNS0095609	Whole white alabastrum(tetraploid) 3	68.838
	CNS0095610	Silvery flower (tetraploid) 1	19.407
	CNS0095611	Silvery flower (tetraploid) 2	18.286
	CNS0095612	Silvery flower (tetraploid) 3	18.794
	CNS0095613	Golden flower (tetraploid) 1	21.474
	CNS0095614	Golden flower (tetraploid) 2	26.265
	CNS0095615	Golden flower (tetraploid) 3	14.201
CRA001975	CRR073297	Stem 1	43.382
	CRR073298	Stem 2	46.123
	CRR073299	Stem 3	31.361
	CRR073300	Leaf 1	59.746
	CRR073301	Leaf 2	50.982
	CRR073302	Leaf 3	43.965
	CRR073303	Juvenile bud 1	46.198
	CRR073304	Juvenile bud 2	35.538
	CRR073305	Juvenile bud 3	38.928
	CRR073306	Third green 1	20.852
	CRR073307	Third green 2	15.350
	CRR073308	Third green 3	15.702
	CRR073309	Second white 1	17.691
	CRR073310	Second white 2	19.161
	CRR073311	Second white 3	21.339
	CRR073312	Silver flowering 1	22.757
	CRR073313	Silver flowering 2	11.653
	CRR073314	Silver flowering 3	8.165
	CRR073315	Gold flowering 1	30.506
	CRR073316	Gold flowering 2	37.837
	CRR073317	Gold flowering 3	23.830
	CRR073318	Tawny withering 1	51.064
	CRR073319	Tawny withering 2	74.024
	CRR073320	Tawny withering 3	37.952