Gene detail

Detail information of GWHGAAZE013897

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011074687.1	3.54348E-44	PREDICTED: tubulin beta-1 chain [Sesamum indicum]
Swissprot	tr\|Q6VAF6\|TBB6_GOSHI	1E-42	Tubulin beta-6 chain
trEMBL	tr\|A0A068UGQ6\|A0A068UGQ6_COFCA	2E-42	Coffea canephora DH200=94 genomic scaffold, scaffold_26 {ECO:0000313\|EMBL:CDP07394.1}
TAIR10	AT1G75780.1	7E-35	tubulin beta-1 chain

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000004	gene	2377922	2378627	+
GWHAAZE00000004	mRNA	2377922	2378627	+
GWHAAZE00000004	exon	2377922	2378138	+
GWHAAZE00000004	exon	2378596	2378627	+
GWHAAZE00000004	CDS	2377922	2378138	+
GWHAAZE00000004	CDS	2378596	2378627	+

Transcript Sequence
>GWHTAAZE013911 ATGAGAGAGATCCTGCACATTCAAGGTGGCCAATGCGGTAACCAGATCGGTTCCAAGTTTTGGGAGGTCATTTGCGATGAGCATGGCGTTGATCCCACCGGTCGTTACAAGGGAGATGGATCCTCCGATAATCAACTCGAGAGGATCAATGTCTATTTCAACGAAGCTTCTGGTGGACGCTATGTTCCCAGAGCTGTGTTGATGGATCTGGAGCCTGAGTGGGACGATGAAGATCAAACTTTTATGTGA

Network for GWHGAAZE013897

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00091.26	Tubulin	3	73	4.40E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07375	TUBB	Phagosome	map04145
K07375	TUBB	Gap junction	map04540

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0005874	cellular_component	microtubule
GO:0003924	molecular_function	GTPase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	252.034
	SRR3591706	second leaf	63.917
	SRR3591707	mature leaf	19.675
	SRR3591708	Shoot apex	108.898
	SRR3591709	Stem	78.059
	SRR3591710	White floral bud	200.526
	SRR3591711	White flower	40.251
	SRR3591712	Green floral bud	215.313
	SRR3591713	Yellow flower	27.860
SRP173429	SRR8316895	Juvenile bud stage	67.978
	SRR8316896	Juvenile bud stage	68.366
	SRR8316897	Juvenile bud stage	43.017
	SRR8316894	Third green stage	46.549
	SRR8316900	Third green stage	217.431
	SRR8316901	Third green stage	181.794
	SRR8316898	Complete white stage	44.828
	SRR8316899	Complete white stage	109.092
	SRR8316903	Complete white stage	59.738
	SRR8316902	Silver flowering stage	16.859
	SRR8316904	Silver flowering stage	35.679
	SRR8316905	Silver flowering stage	17.319
	SRR8316906	Gold flowering stage	46.537
	SRR8316907	Gold flowering stage	45.694
	SRR8316908	Gold flowering stage	47.235
SRP132670	SRR6706286	Control	311.248
	SRR6706287	Light intensity 50%	338.784
	SRR6706288	Light intensity 20%	382.295
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	107.912
	CNS0095593	Slightly white alabastrum(diploid) 2	101.068
	CNS0095594	Slightly white alabastrum(diploid) 3	96.445
	CNS0095595	Whole white alabastrum(diploid) 2	206.553
	CNS0095596	Whole white alabastrum(diploid) 3	239.408
	CNS0095597	Whole white alabastrum(diploid) 4	275.876
	CNS0095598	Silvery flower (diploied) 1	48.173
	CNS0095599	Silvery flower (diploied) 2	74.682
	CNS0095600	Silvery flower (diploied) 3	83.307
	CNS0095601	Golden flower (diploid) 1	40.493
	CNS0095602	Golden flower (diploid) 2	84.776
	CNS0095603	Golden flower (diploid) 3	94.498
	CNS0095604	Slightly white alabastrum(tetraploid) 1	197.063
	CNS0095605	Slightly white alabastrum(tetraploid) 2	173.618
	CNS0095606	Slightly white alabastrum(tetraploid) 3	171.855
	CNS0095607	Whole white alabastrum(tetraploid) 1	321.479
	CNS0095608	Whole white alabastrum(tetraploid) 2	351.521
	CNS0095609	Whole white alabastrum(tetraploid) 3	312.779
	CNS0095610	Silvery flower (tetraploid) 1	63.500
	CNS0095611	Silvery flower (tetraploid) 2	96.284
	CNS0095612	Silvery flower (tetraploid) 3	95.880
	CNS0095613	Golden flower (tetraploid) 1	36.875
	CNS0095614	Golden flower (tetraploid) 2	47.432
	CNS0095615	Golden flower (tetraploid) 3	82.414
CRA001975	CRR073297	Stem 1	158.980
	CRR073298	Stem 2	152.580
	CRR073299	Stem 3	217.454
	CRR073300	Leaf 1	280.807
	CRR073301	Leaf 2	231.643
	CRR073302	Leaf 3	332.873
	CRR073303	Juvenile bud 1	356.511
	CRR073304	Juvenile bud 2	377.199
	CRR073305	Juvenile bud 3	233.045
	CRR073306	Third green 1	314.937
	CRR073307	Third green 2	299.120
	CRR073308	Third green 3	273.316
	CRR073309	Second white 1	72.652
	CRR073310	Second white 2	48.871
	CRR073311	Second white 3	40.977
	CRR073312	Silver flowering 1	82.680
	CRR073313	Silver flowering 2	86.050
	CRR073314	Silver flowering 3	52.232
	CRR073315	Gold flowering 1	196.105
	CRR073316	Gold flowering 2	177.798
	CRR073317	Gold flowering 3	175.120
	CRR073318	Tawny withering 1	263.005
	CRR073319	Tawny withering 2	161.891
	CRR073320	Tawny withering 3	289.423