Gene detail

Detail information of GWHGAAZE013689

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008368264.1	2.95678E-40	PREDICTED: vinorine synthase-like [Malus domestica]
Swissprot	tr\|Q70PR7\|VINSY_RAUSE	1E-20	Vinorine synthase
trEMBL	tr\|A0A061E719\|A0A061E719_THECC	2E-40	HXXXD-type acyl-transferase family protein, putative {ECO:0000313\|EMBL:EOY00795.1}
TAIR10	AT1G24430.1	1E-27	HXXXD-type acyl-transferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	106432698	106433493	+
GWHAAZE00000003	mRNA	106432698	106433493	+
GWHAAZE00000003	exon	106432698	106433077	+
GWHAAZE00000003	exon	106433201	106433286	+
GWHAAZE00000003	exon	106433423	106433493	+
GWHAAZE00000003	CDS	106432698	106433077	+
GWHAAZE00000003	CDS	106433201	106433286	+
GWHAAZE00000003	CDS	106433423	106433493	+

Transcript Sequence
>GWHTAAZE013703 ATGATTATGACAATGGCTACTTTCCGTACAAGTCACAGCTTCTTTGATTGTGGAGACATGGCAATTGGTGTGTGCACTTCTCACAAGATTGCTGACGTGTTGTCCATTGTCATGTTGATTACTACTTGGGCTCAAACAGCTCGTGGGGACAATAAAATAGTTTCTCCCCAGTTTGAATCGGCCAAGTTGTTTCCGCCTAAAAATATATCGGGTTATCAAACAAGGGTTGGGATGACAAAGGACAAGATTGTGACAAAGAGGTTTGTGTTTACTAATTCCACGGTCGCTTCTCTAAGAGCTAAGTATAGCGATAACACTAGTAAAGCCTGTCTGCTTCGCGCAACACGTGTTGAGGGCTTATCGGCTTTTATATGGAAAAGAATAGCAATGTCAATGCCAACAATGGAAACATTAGATGAGTGTGGTGGACTTGTGAGGCAGATGAGAGAGACAATAAAGAATATAGCTGATTTTGGGCAGGGCAAGCCTGTGAGGGTTGGATCGGCAAGGTTGCCATTTGAGAATCTGGCGAGGTGA

Network for GWHGAAZE013689

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02458.16	Transferase	14	133	5.70E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13065	E2.3.1.133, HCT	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940
		Stilbenoid, diarylheptanoid and gingerol biosynthesis	map00945
		Flavonoid biosynthesis	map00941

Gene Ontology

GO term	Ontology	Name
GO:0016747	molecular_function	transferase activity, transferring acyl groups other than amino-acyl groups

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.571
	SRR3591706	second leaf	0.365
	SRR3591707	mature leaf	1.851
	SRR3591708	Shoot apex	0.479
	SRR3591709	Stem	0.828
	SRR3591710	White floral bud	0.833
	SRR3591711	White flower	0.716
	SRR3591712	Green floral bud	0.714
	SRR3591713	Yellow flower	0.356
SRP173429	SRR8316895	Juvenile bud stage	0.506
	SRR8316896	Juvenile bud stage	0.617
	SRR8316897	Juvenile bud stage	0.247
	SRR8316894	Third green stage	0.102
	SRR8316900	Third green stage	0.153
	SRR8316901	Third green stage	0.607
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.658
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.222
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.171
	SRR8316907	Gold flowering stage	0.030
	SRR8316908	Gold flowering stage	0.116
SRP132670	SRR6706286	Control	0.297
	SRR6706287	Light intensity 50%	0.404
	SRR6706288	Light intensity 20%	0.136
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.092
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.105
	CNS0095595	Whole white alabastrum(diploid) 2	0.220
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.053
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.166
	CNS0095601	Golden flower (diploid) 1	0.314
	CNS0095602	Golden flower (diploid) 2	0.218
	CNS0095603	Golden flower (diploid) 3	0.166
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.335
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.624
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.109
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.231
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.187
	CNS0095610	Silvery flower (tetraploid) 1	0.312
	CNS0095611	Silvery flower (tetraploid) 2	0.786
	CNS0095612	Silvery flower (tetraploid) 3	0.147
	CNS0095613	Golden flower (tetraploid) 1	0.100
	CNS0095614	Golden flower (tetraploid) 2	0.561
	CNS0095615	Golden flower (tetraploid) 3	0.508
CRA001975	CRR073297	Stem 1	0.512
	CRR073298	Stem 2	0.293
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.250
	CRR073301	Leaf 2	0.294
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.056
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.127
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.026
	CRR073309	Second white 1	0.003
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.604
	CRR073316	Gold flowering 2	0.567
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.158
	CRR073320	Tawny withering 3	0.161